PASK Rabbit Polyclonal Antibody

PASK Rabbit Polyclonal Antibody

To Order:

PASK Polyclonal Antibody

ABP59837-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human PASK protein at amino acid sequence of 1100-1180
  • Applications tips:
Description: A polyclonal antibody for detection of PASK from Human, Mouse. This PASK antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PASK protein at amino acid sequence of 1100-1180

PASK Polyclonal Antibody

ABP59837-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human PASK protein at amino acid sequence of 1100-1180
  • Applications tips:
Description: A polyclonal antibody for detection of PASK from Human, Mouse. This PASK antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PASK protein at amino acid sequence of 1100-1180

PASK Polyclonal Antibody

ABP59837-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human PASK protein at amino acid sequence of 1100-1180
  • Applications tips:
Description: A polyclonal antibody for detection of PASK from Human, Mouse. This PASK antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PASK protein at amino acid sequence of 1100-1180

PASK Polyclonal Antibody

A70035 100 ?g
EUR 628.55
Description: fast delivery possible

PASK Polyclonal Antibody

31656-100ul 100ul
EUR 252

PASK Polyclonal Antibody

31656-50ul 50ul
EUR 187

PASK Rabbit pAb

A8995-100ul 100 ul
EUR 308

PASK Rabbit pAb

A8995-200ul 200 ul
EUR 459

PASK Rabbit pAb

A8995-20ul 20 ul
EUR 183

PASK Rabbit pAb

A8995-50ul 50 ul
EUR 223

PASK Polyclonal Conjugated Antibody

C31656 100ul
EUR 397

PASK Antibody

ABD13196 100 ug
EUR 438

PASK antibody

22236-100ul 100ul
EUR 390

PASK antibody

10R-5159 100 ul
EUR 691
Description: Mouse monoclonal PASK antibody

PASK antibody

10R-5160 100 ul
EUR 691
Description: Mouse monoclonal PASK antibody

PASK antibody

10R-5161 100 ul
EUR 726
Description: Mouse monoclonal PASK antibody

PASK antibody

70R-13125 100 ul
EUR 457
Description: Affinity purified Rabbit polyclonal PASK antibody

PASK Antibody

DF10342 200ul
EUR 304
Description: PASK Antibody detects endogenous levels of PASK.

PASK Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PASK. Recognizes PASK from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IF; Recommended dilution: IF:1:200-1:500

PASK Polyclonal Antibody, HRP Conjugated

A70036 100 ?g
EUR 628.55
Description: reagents widely cited

PASK Polyclonal Antibody, FITC Conjugated

A70037 100 ?g
EUR 628.55
Description: Ask the seller for details

PASK Polyclonal Antibody, Biotin Conjugated

A70038 100 ?g
EUR 628.55
Description: The best epigenetics products

PASK (Phospho-Thr1165) Polyclonal Conjugated Antibody

C12526 100ul
EUR 397

anti- PASK antibody

FNab06165 100µg
EUR 505.25
  • Immunogen: PAS domain containing serine/threonine kinase
  • Uniprot ID: Q96RG2
  • Gene ID: 23178
  • Research Area: Signal Transduction
Description: Antibody raised against PASK

PASK (pT1165) Antibody

abx217647-100ug 100 ug
EUR 439
  • Shipped within 5-10 working days.

Anti-PASK antibody

PAab06165 100 ug
EUR 355

Anti-PASK antibody

STJ116338 100 µl
EUR 277
Description: This gene encodes a member of the serine/threonine kinase family that contains two PAS domains. Expression of this gene is regulated by glucose, and the encoded protein plays a role in the regulation of insulin gene expression. Downregulation of this gene may play a role in type 2 diabetes. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene.

Anti-PASK antibody

STJ190115 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to PASK


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


YF-PA25847 50 ul
EUR 334
Description: Mouse polyclonal to PASK

Phospho-PASK (Thr1165) Antibody

AF8179 200ul
EUR 376
Description: PASK (Phospho-Thr1165) Antibody detects endogenous levels of PASK only when phosphorylated at Thr1165.

PASK (Phospho- Thr1165) Antibody

ABF8179 100 ug
EUR 438

PASK (Phospho-Thr1165) Antibody

12526-100ul 100ul
EUR 252

PASK (Phospho-Thr1165) Antibody

12526-50ul 50ul
EUR 187

PASK Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PASK. Recognizes PASK from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

PASK Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PASK. Recognizes PASK from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

PASK Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PASK. Recognizes PASK from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

PASK Blocking Peptide

DF10342-BP 1mg
EUR 195

PASK cloning plasmid

CSB-CL822296HU1-10ug 10ug
EUR 1393
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 3972
  • Sequence: atggaggacgggggcttaacagcctttgaagaggaccagagatgcctttcccagagcctccccttgccagtgtcagcagagggcccagctgcacagaccactgctgagcccagcaggtcgttttcctcagcccacagacacctgagcagaaggaatgggctttccagactctgcc
  • Show more
Description: A cloning plasmid for the PASK gene.

PASK cloning plasmid

CSB-CL822296HU2-10ug 10ug
EUR 1218
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 3432
  • Show more
Description: A cloning plasmid for the PASK gene.

pASK- IBA5plus++FUS

PVT10149 2 ug
EUR 266

Anti-PASK (6D10)

YF-MA17817 100 ug
EUR 363
Description: Mouse monoclonal to PASK

Anti-PASK (6B7)

YF-MA17818 200 ul
EUR 363
Description: Mouse monoclonal to PASK

Mouse PASK shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.


EF001573 96 Tests
EUR 689

Mouse Pask ELISA KIT

ELI-45065m 96 Tests
EUR 865


ELI-37789h 96 Tests
EUR 824

Human PASK shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Monoclonal PASK Antibody (monoclonal) (M01), Clone: 6D10

APR17759G 0.1mg
EUR 484
Description: A Monoclonal antibody against Human PASK (monoclonal) (M01). The antibodies are raised in mouse and are from clone 6D10. This antibody is applicable in WB, E

Phospho-PASK (Thr1165) Blocking Peptide

AF8179-BP 1mg
EUR 195

PASK ORF Vector (Human) (pORF)

ORF007540 1.0 ug DNA
EUR 95

Pask ORF Vector (Rat) (pORF)

ORF073123 1.0 ug DNA
EUR 2080

PASK Rabbit Polyclonal Antibody

Back To Top