PASK Rabbit Polyclonal Antibody
To Order: garrett@bioworldantibodies.com
PASK Polyclonal Antibody |
A70035 |
EpiGentek |
100 ?g |
EUR 628.55 |
Description: fast delivery possible |
PASK Polyclonal Antibody |
ABP59837-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Synthesized peptide derived from part region of human PASK protein at amino acid sequence of 1100-1180
- Applications tips:
|
Description: A polyclonal antibody for detection of PASK from Human, Mouse. This PASK antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PASK protein at amino acid sequence of 1100-1180 |
PASK Polyclonal Antibody |
ABP59837-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from part region of human PASK protein at amino acid sequence of 1100-1180
- Applications tips:
|
Description: A polyclonal antibody for detection of PASK from Human, Mouse. This PASK antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PASK protein at amino acid sequence of 1100-1180 |
PASK Polyclonal Antibody |
ABP59837-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human PASK protein at amino acid sequence of 1100-1180
- Applications tips:
|
Description: A polyclonal antibody for detection of PASK from Human, Mouse. This PASK antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PASK protein at amino acid sequence of 1100-1180 |
PASK Polyclonal Antibody |
ES8957-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against PASK from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA |
PASK Polyclonal Antibody |
ES8957-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against PASK from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA |
PASK Rabbit pAb |
A8995-100ul |
Abclonal |
100 ul |
EUR 308 |
PASK Rabbit pAb |
A8995-200ul |
Abclonal |
200 ul |
EUR 459 |
PASK Rabbit pAb |
A8995-20ul |
Abclonal |
20 ul |
EUR 183 |
PASK Rabbit pAb |
A8995-50ul |
Abclonal |
50 ul |
EUR 223 |
PASK Polyclonal Conjugated Antibody |
C31656 |
SAB |
100ul |
EUR 397 |
PASK antibody |
22236-100ul |
SAB |
100ul |
EUR 390 |
PASK antibody |
70R-13125 |
Fitzgerald |
100 ul |
EUR 457 |
Description: Affinity purified Rabbit polyclonal PASK antibody |
PASK antibody |
10R-5159 |
Fitzgerald |
100 ul |
EUR 691 |
Description: Mouse monoclonal PASK antibody |
PASK antibody |
10R-5160 |
Fitzgerald |
100 ul |
EUR 691 |
Description: Mouse monoclonal PASK antibody |
PASK antibody |
10R-5161 |
Fitzgerald |
100 ul |
EUR 726 |
Description: Mouse monoclonal PASK antibody |
PASK Antibody |
1-CSB-PA822296LA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against PASK. Recognizes PASK from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IF; Recommended dilution: IF:1:200-1:500 |
PASK Antibody |
DF10342 |
Affbiotech |
200ul |
EUR 304 |
Description: PASK Antibody detects endogenous levels of PASK. |
PASK Polyclonal Antibody, HRP Conjugated |
A70036 |
EpiGentek |
100 ?g |
EUR 628.55 |
Description: reagents widely cited |
PASK Polyclonal Antibody, FITC Conjugated |
A70037 |
EpiGentek |
100 ?g |
EUR 628.55 |
Description: Ask the seller for details |
PASK Polyclonal Antibody, Biotin Conjugated |
A70038 |
EpiGentek |
100 ?g |
EUR 628.55 |
Description: The best epigenetics products |
PASK (Phospho-Thr1165) Polyclonal Conjugated Antibody |
C12526 |
SAB |
100ul |
EUR 397 |
PASK (pT1165) Antibody |
abx217647-100ug |
Abbexa |
100 ug |
EUR 439 |
- Shipped within 5-10 working days.
|
anti- PASK antibody |
FNab06165 |
FN Test |
100µg |
EUR 505.25 |
- Immunogen: PAS domain containing serine/threonine kinase
- Uniprot ID: Q96RG2
- Gene ID: 23178
- Research Area: Signal Transduction
|
Description: Antibody raised against PASK |
Anti-PASK antibody |
STJ116338 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: This gene encodes a member of the serine/threonine kinase family that contains two PAS domains. Expression of this gene is regulated by glucose, and the encoded protein plays a role in the regulation of insulin gene expression. Downregulation of this gene may play a role in type 2 diabetes. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. |
Anti-PASK antibody |
STJ190115 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to PASK |
PASK siRNA |
20-abx927783 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
PASK siRNA |
20-abx927784 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
anti-PASK |
YF-PA25847 |
Abfrontier |
50 ul |
EUR 334 |
Description: Mouse polyclonal to PASK |
PASK (Phospho-Thr1165) Antibody |
12526-100ul |
SAB |
100ul |
EUR 252 |
PASK (Phospho-Thr1165) Antibody |
12526-50ul |
SAB |
50ul |
EUR 187 |
PASK Antibody, HRP conjugated |
1-CSB-PA822296LB01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against PASK. Recognizes PASK from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
PASK Antibody, FITC conjugated |
1-CSB-PA822296LC01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against PASK. Recognizes PASK from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
PASK Antibody, Biotin conjugated |
1-CSB-PA822296LD01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against PASK. Recognizes PASK from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
Phospho-PASK (Thr1165) Antibody |
AF8179 |
Affbiotech |
200ul |
EUR 376 |
Description: PASK (Phospho-Thr1165) Antibody detects endogenous levels of PASK only when phosphorylated at Thr1165. |
PASK Blocking Peptide |
DF10342-BP |
Affbiotech |
1mg |
EUR 195 |
PASK cloning plasmid |
CSB-CL822296HU1-10ug |
Cusabio |
10ug |
EUR 1393 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 3972
- Sequence: atggaggacgggggcttaacagcctttgaagaggaccagagatgcctttcccagagcctccccttgccagtgtcagcagagggcccagctgcacagaccactgctgagcccagcaggtcgttttcctcagcccacagacacctgagcagaaggaatgggctttccagactctgcc
- Show more
|
Description: A cloning plasmid for the PASK gene. |
PASK cloning plasmid |
CSB-CL822296HU2-10ug |
Cusabio |
10ug |
EUR 1218 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 3432
- Sequence: ATGGAGGACGGGGGCTTAACAGCCTTTGAAGAGGACCAGAGATGCCTTTCCCAGAGCCTCCCCTTGCCAGTGTCAGCAGAGGGCCCAGCTGCACAGACCACTGCTGAGCCCAGCAGGTCGTTTTCCTCAGCCCACAGACACCTGAGCAGAAGGAATGGGCTTTCCAGACTCTGCC
- Show more
|
Description: A cloning plasmid for the PASK gene. |
Anti-PASK (6D10) |
YF-MA17817 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to PASK |
Anti-PASK (6B7) |
YF-MA17818 |
Abfrontier |
200 ul |
EUR 363 |
Description: Mouse monoclonal to PASK |
Human PASK shRNA Plasmid |
20-abx958061 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Mouse PASK shRNA Plasmid |
20-abx983023 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Monoclonal PASK Antibody (monoclonal) (M01), Clone: 6D10 |
APR17759G |
Leading Biology |
0.1mg |
EUR 484 |
Description: A Monoclonal antibody against Human PASK (monoclonal) (M01). The antibodies are raised in mouse and are from clone 6D10. This antibody is applicable in WB, E |
Phospho-PASK (Thr1165) Blocking Peptide |
AF8179-BP |
Affbiotech |
1mg |
EUR 195 |
Pask ORF Vector (Rat) (pORF) |
ORF073123 |
ABM |
1.0 ug DNA |
EUR 2080 |
PASK ORF Vector (Human) (pORF) |
ORF014012 |
ABM |
1.0 ug DNA |
EUR 354 |
PASK Rabbit Polyclonal Antibody