PCBP2 Rabbit Polyclonal Antibody
To Order: garrett@bioworldantibodies.com
PCBP2 Polyclonal Antibody |
ES9065-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against PCBP2 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA |
PCBP2 Rabbit pAb |
A2531-100ul |
Abclonal |
100 ul |
EUR 308 |
PCBP2 Rabbit pAb |
A2531-200ul |
Abclonal |
200 ul |
EUR 459 |
PCBP2 Rabbit pAb |
A2531-20ul |
Abclonal |
20 ul |
EUR 183 |
PCBP2 Rabbit pAb |
A2531-50ul |
Abclonal |
50 ul |
EUR 223 |
PCBP2 antibody |
22117-100ul |
SAB |
100ul |
EUR 390 |
PCBP2 antibody |
70R-19135 |
Fitzgerald |
50 ul |
EUR 435 |
Description: Rabbit polyclonal PCBP2 antibody |
PCBP2 antibody |
70R-13182 |
Fitzgerald |
100 ul |
EUR 457 |
Description: Affinity purified Rabbit polyclonal PCBP2 antibody |
PCBP2 antibody |
70R-13611 |
Fitzgerald |
100 ul |
EUR 457 |
Description: Affinity purified Rabbit polyclonal PCBP2 antibody |
PCBP2 antibody |
70R-1378 |
Fitzgerald |
100 ug |
EUR 377 |
Description: Rabbit polyclonal PCBP2 antibody |
PCBP2 antibody |
70R-1465 |
Fitzgerald |
100 ug |
EUR 377 |
Description: Rabbit polyclonal PCBP2 antibody |
PCBP2 Antibody |
32696-100ul |
SAB |
100ul |
EUR 252 |
PCBP2 Antibody |
1-CSB-PA622995LA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against PCBP2. Recognizes PCBP2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:500-1:5000, IHC:1:200-1:500 |
PCBP2 Antibody |
DF6991 |
Affbiotech |
200ul |
EUR 304 |
Description: PCBP2 Antibody detects endogenous levels of total PCBP2. |
PCBP2 Antibody |
1-CSB-PA017517GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
|
Description: A polyclonal antibody against PCBP2. Recognizes PCBP2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB |
PCBP2 Conjugated Antibody |
C32696 |
SAB |
100ul |
EUR 397 |
anti- PCBP2 antibody |
FNab06191 |
FN Test |
100µg |
EUR 505.25 |
- Recommended dilution: WB: 1:1000 - 1:2000
- IHC: 1:50 - 1:200
- Immunogen: poly(rC) binding protein 2
- Uniprot ID: Q15366
- Gene ID: 5094
- Research Area: Immunology, Metabolism
|
Description: Antibody raised against PCBP2 |
Anti-PCBP2 antibody |
STJ24914 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: The protein encoded by this gene appears to be multifunctional. Along with PCBP-1 and hnRNPK, it is one of the major cellular poly(rC)-binding proteins. The encoded protein contains three K-homologous (KH) domains which may be involved in RNA binding. Together with PCBP-1, this protein also functions as a translational coactivator of poliovirus RNA via a sequence-specific interaction with stem-loop IV of the IRES, promoting poliovirus RNA replication by binding to its 5'-terminal cloverleaf structure. It has also been implicated in translational control of the 15-lipoxygenase mRNA, human papillomavirus type 16 L2 mRNA, and hepatitis A virus RNA. The encoded protein is also suggested to play a part in formation of a sequence-specific alpha-globin mRNP complex which is associated with alpha-globin mRNA stability. This multiexon structural mRNA is thought to be retrotransposed to generate PCBP-1, an intronless gene with functions similar to that of PCBP2. This gene and PCBP-1 have paralogous genes (PCBP3 and PCBP4) which are thought to have arisen as a result of duplication events of entire genes. Thsi gene also has two processed pseudogenes (PCBP2P1 and PCBP2P2). Multiple transcript variants encoding different isoforms have been found for this gene. |
Anti-PCBP2 antibody |
STJ190223 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to PCBP2 |
PCBP2 siRNA |
20-abx927849 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
PCBP2 siRNA |
20-abx927850 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
anti-PCBP2 |
YF-PA13628 |
Abfrontier |
100 ul |
EUR 403 |
Description: Rabbit polyclonal to PCBP2 |
PCBP2 Antibody, HRP conjugated |
1-CSB-PA622995LB01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against PCBP2. Recognizes PCBP2 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
PCBP2 Antibody, FITC conjugated |
1-CSB-PA622995LC01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against PCBP2. Recognizes PCBP2 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
PCBP2 Antibody, Biotin conjugated |
1-CSB-PA622995LD01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against PCBP2. Recognizes PCBP2 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
PCBP2 Blocking Peptide |
33R-4463 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of PCBP2 antibody, catalog no. 70R-1465 |
PCBP2 Blocking Peptide |
33R-9591 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of PCBP2 antibody, catalog no. 70R-1378 |
PCBP2 Blocking Peptide |
DF6991-BP |
Affbiotech |
1mg |
EUR 195 |
PCBP2 cloning plasmid |
CSB-CL622995HU1-10ug |
Cusabio |
10ug |
EUR 415 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1089
- Sequence: atggacaccggtgtgattgaaggtggattaaatgtcactctcaccatccggctacttatgcatggaaaggaagttggcagtatcatcggaaagaaaggagaatcagttaagaagatgcgcgaggagagtggtgcacgtatcaacatctcagaagggaattgtcctgagagaatta
- Show more
|
Description: A cloning plasmid for the PCBP2 gene. |
PCBP2 cloning plasmid |
CSB-CL622995HU2-10ug |
Cusabio |
10ug |
EUR 418 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1101
- Sequence: atggacaccggtgtgattgaaggtggattaaatgtcactctcaccatccggctacttatgcatggaaaggaagttggcagtatcatcggaaagaaaggagaatcagttaagaagatgcgcgaggagagtggtgcacgtatcaacatctcagaagggaattgtcctgagagaatta
- Show more
|
Description: A cloning plasmid for the PCBP2 gene. |
Anti-PCBP2 (5F12) |
YF-MA10666 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to PCBP2 |
Mouse PCBP2 shRNA Plasmid |
20-abx971941 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Human PCBP2 shRNA Plasmid |
20-abx953388 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
PCBP2 Recombinant Protein (Human) |
RP022663 |
ABM |
100 ug |
Ask for price |
PCBP2 Recombinant Protein (Human) |
RP022666 |
ABM |
100 ug |
Ask for price |
PCBP2 Recombinant Protein (Mouse) |
RP160352 |
ABM |
100 ug |
Ask for price |
PCBP2 Recombinant Protein (Mouse) |
RP160355 |
ABM |
100 ug |
Ask for price |
PCBP2 Recombinant Protein (Mouse) |
RP160358 |
ABM |
100 ug |
Ask for price |
PCBP2 Recombinant Protein (Mouse) |
RP160361 |
ABM |
100 ug |
Ask for price |
PCBP2 Recombinant Protein (Rat) |
RP219440 |
ABM |
100 ug |
Ask for price |
Monoclonal PCBP2 Antibody (monoclonal) (M07), Clone: 5F12 |
APG02955G |
Leading Biology |
0.1mg |
EUR 484 |
Description: A Monoclonal antibody against Human PCBP2 (monoclonal) (M07). The antibodies are raised in mouse and are from clone 5F12. This antibody is applicable in WB, IHC and IF, E |
Monoclonal PCBP2 Antibody (monoclonal) (M02), Clone: 1B6 |
APR10965G |
Leading Biology |
0.1mg |
EUR 484 |
Description: A Monoclonal antibody against Human PCBP2 (monoclonal) (M02). The antibodies are raised in mouse and are from clone 1B6. This antibody is applicable in WB, E |
Poly(Rc) Binding Protein 2 (PCBP2) Antibody |
20-abx114578 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Poly(RC) Binding Protein 2 (PCBP2) Antibody |
abx236191-100ug |
Abbexa |
100 ug |
EUR 481 |
- Shipped within 5-12 working days.
|
Poly(RC) Binding Protein 2 (PCBP2) Antibody |
20-abx338495 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Poly(RC) Binding Protein 2 (PCBP2) Antibody |
20-abx001971 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
Pcbp2 ORF Vector (Rat) (pORF) |
ORF073148 |
ABM |
1.0 ug DNA |
EUR 506 |
h PCBP2 inducible lentiviral particles |
LVP278 |
GenTarget |
1x107 IFU/ml x 200ul |
EUR 451 |
Description: Pre-made tet-inducible lentiviral particles expressing a human gene with a Blasticidin-RFP fusion marker (Dual selection). The expressed human gene, PCBP2, is fully sequence verified and matched to NCBI accession ID: NM_031989.4 |
PCBP2 ORF Vector (Human) (pORF) |
ORF007555 |
ABM |
1.0 ug DNA |
EUR 95 |
PCBP2 ORF Vector (Human) (pORF) |
ORF007556 |
ABM |
1.0 ug DNA |
EUR 95 |
Pcbp2 ORF Vector (Mouse) (pORF) |
ORF053452 |
ABM |
1.0 ug DNA |
EUR 506 |
Pcbp2 ORF Vector (Mouse) (pORF) |
ORF053453 |
ABM |
1.0 ug DNA |
EUR 506 |
Pcbp2 ORF Vector (Mouse) (pORF) |
ORF053454 |
ABM |
1.0 ug DNA |
EUR 506 |
Pcbp2 ORF Vector (Mouse) (pORF) |
ORF053455 |
ABM |
1.0 ug DNA |
EUR 506 |
Anti-PCBP2/hnRNP E2 (1B6) |
YF-MA14610 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to PCBP2/hnRNP E2 |
Anti-PCBP2/hnRNP E2 (3A1) |
YF-MA14611 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to PCBP2/hnRNP E2 |
Anti-PCBP2/hnRNP E2 (1C7) |
YF-MA14612 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to PCBP2/hnRNP E2 |
Anti-PCBP2/hnRNP E2 (6B6) |
YF-MA14613 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to PCBP2/hnRNP E2 |
Anti-PCBP2/hnRNP E2 (6E9) |
YF-MA14614 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to PCBP2/hnRNP E2 |
Poly(RC) Binding Protein 2 (PCBP2) Antibody (HRP) |
20-abx337084 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Poly(RC) Binding Protein 2 (PCBP2) Antibody (FITC) |
20-abx337085 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Poly(RC) Binding Protein 2 (PCBP2) Antibody (Biotin) |
20-abx337086 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Pcbp2 sgRNA CRISPR Lentivector set (Mouse) |
K4799401 |
ABM |
3 x 1.0 ug |
EUR 339 |
Pcbp2 sgRNA CRISPR Lentivector set (Rat) |
K6494301 |
ABM |
3 x 1.0 ug |
EUR 339 |
PCBP2 sgRNA CRISPR Lentivector set (Human) |
K1601201 |
ABM |
3 x 1.0 ug |
EUR 339 |
Monoclonal HNRNP-E2 / PCBP2 Antibody (clone 5F12), Clone: 5F12 |
AMM05385G |
Leading Biology |
0.05mg |
EUR 528 |
Description: A Monoclonal antibody against Human HNRNP-E2 / PCBP2 (clone 5F12). The antibodies are raised in Mouse and are from clone 5F12. This antibody is applicable in WB and IHC-P, IF, E, RNAi |
Pcbp2 sgRNA CRISPR Lentivector (Mouse) (Target 1) |
K4799402 |
ABM |
1.0 ug DNA |
EUR 154 |
Pcbp2 sgRNA CRISPR Lentivector (Mouse) (Target 2) |
K4799403 |
ABM |
1.0 ug DNA |
EUR 154 |
Pcbp2 sgRNA CRISPR Lentivector (Mouse) (Target 3) |
K4799404 |
ABM |
1.0 ug DNA |
EUR 154 |
Pcbp2 sgRNA CRISPR Lentivector (Rat) (Target 1) |
K6494302 |
ABM |
1.0 ug DNA |
EUR 154 |
Pcbp2 sgRNA CRISPR Lentivector (Rat) (Target 2) |
K6494303 |
ABM |
1.0 ug DNA |
EUR 154 |
Pcbp2 sgRNA CRISPR Lentivector (Rat) (Target 3) |
K6494304 |
ABM |
1.0 ug DNA |
EUR 154 |
PCBP2 sgRNA CRISPR Lentivector (Human) (Target 1) |
K1601202 |
ABM |
1.0 ug DNA |
EUR 154 |
PCBP2 sgRNA CRISPR Lentivector (Human) (Target 2) |
K1601203 |
ABM |
1.0 ug DNA |
EUR 154 |
PCBP2 sgRNA CRISPR Lentivector (Human) (Target 3) |
K1601204 |
ABM |
1.0 ug DNA |
EUR 154 |
PCBP2 Protein Vector (Rat) (pPB-C-His) |
PV292590 |
ABM |
500 ng |
EUR 603 |
PCBP2 Protein Vector (Rat) (pPB-N-His) |
PV292591 |
ABM |
500 ng |
EUR 603 |
PCBP2 Protein Vector (Rat) (pPM-C-HA) |
PV292592 |
ABM |
500 ng |
EUR 603 |
PCBP2 Protein Vector (Rat) (pPM-C-His) |
PV292593 |
ABM |
500 ng |
EUR 603 |
PCBP2 Protein Vector (Mouse) (pPB-C-His) |
PV213806 |
ABM |
500 ng |
EUR 603 |
PCBP2 Protein Vector (Mouse) (pPB-N-His) |
PV213807 |
ABM |
500 ng |
EUR 603 |
PCBP2 Protein Vector (Mouse) (pPM-C-HA) |
PV213808 |
ABM |
500 ng |
EUR 603 |
PCBP2 Protein Vector (Mouse) (pPM-C-His) |
PV213809 |
ABM |
500 ng |
EUR 603 |
PCBP2 Protein Vector (Mouse) (pPB-C-His) |
PV213810 |
ABM |
500 ng |
EUR 603 |
PCBP2 Protein Vector (Mouse) (pPB-N-His) |
PV213811 |
ABM |
500 ng |
EUR 603 |
PCBP2 Protein Vector (Mouse) (pPM-C-HA) |
PV213812 |
ABM |
500 ng |
EUR 603 |
PCBP2 Protein Vector (Mouse) (pPM-C-His) |
PV213813 |
ABM |
500 ng |
EUR 603 |
PCBP2 Protein Vector (Mouse) (pPB-C-His) |
PV213814 |
ABM |
500 ng |
EUR 603 |
PCBP2 Protein Vector (Mouse) (pPB-N-His) |
PV213815 |
ABM |
500 ng |
EUR 603 |
PCBP2 Protein Vector (Mouse) (pPM-C-HA) |
PV213816 |
ABM |
500 ng |
EUR 603 |
PCBP2 Protein Vector (Mouse) (pPM-C-His) |
PV213817 |
ABM |
500 ng |
EUR 603 |
PCBP2 Protein Vector (Mouse) (pPB-C-His) |
PV213818 |
ABM |
500 ng |
EUR 603 |
PCBP2 Protein Vector (Mouse) (pPB-N-His) |
PV213819 |
ABM |
500 ng |
EUR 603 |
PCBP2 Protein Vector (Mouse) (pPM-C-HA) |
PV213820 |
ABM |
500 ng |
EUR 603 |
PCBP2 Protein Vector (Mouse) (pPM-C-His) |
PV213821 |
ABM |
500 ng |
EUR 603 |
PCBP2 Protein Vector (Human) (pPB-C-His) |
PV030217 |
ABM |
500 ng |
EUR 329 |
PCBP2 Protein Vector (Human) (pPB-N-His) |
PV030218 |
ABM |
500 ng |
EUR 329 |
PCBP2 Protein Vector (Human) (pPM-C-HA) |
PV030219 |
ABM |
500 ng |
EUR 329 |
PCBP2 Protein Vector (Human) (pPM-C-His) |
PV030220 |
ABM |
500 ng |
EUR 329 |
PCBP2 Protein Vector (Human) (pPB-C-His) |
PV030221 |
ABM |
500 ng |
EUR 329 |
PCBP2 Protein Vector (Human) (pPB-N-His) |
PV030222 |
ABM |
500 ng |
EUR 329 |
PCBP2 Protein Vector (Human) (pPM-C-HA) |
PV030223 |
ABM |
500 ng |
EUR 329 |
PCBP2 Protein Vector (Human) (pPM-C-His) |
PV030224 |
ABM |
500 ng |
EUR 329 |
Pcbp2 3'UTR Luciferase Stable Cell Line |
TU115962 |
ABM |
1.0 ml |
Ask for price |
Pcbp2 3'UTR GFP Stable Cell Line |
TU165962 |
ABM |
1.0 ml |
Ask for price |
Pcbp2 3'UTR Luciferase Stable Cell Line |
TU215860 |
ABM |
1.0 ml |
Ask for price |
Pcbp2 3'UTR GFP Stable Cell Line |
TU265860 |
ABM |
1.0 ml |
Ask for price |
PCBP2 3'UTR GFP Stable Cell Line |
TU067465 |
ABM |
1.0 ml |
EUR 1521 |
PCBP2 3'UTR Luciferase Stable Cell Line |
TU017465 |
ABM |
1.0 ml |
EUR 1521 |
PCBP2 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV) |
LV713127 |
ABM |
1.0 ug DNA |
EUR 316 |
PCBP2 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC) |
LV713131 |
ABM |
1.0 ug DNA |
EUR 316 |
PCBP2 Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a) |
LV713132 |
ABM |
1.0 ug DNA |
EUR 316 |
PCBP2 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV) |
LV669355 |
ABM |
1.0 ug DNA |
EUR 682 |
PCBP2 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC) |
LV669359 |
ABM |
1.0 ug DNA |
EUR 682 |
PCBP2 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a) |
LV669360 |
ABM |
1.0 ug DNA |
EUR 682 |
GAPDH Rabbit Polyclonal Antibody |
37985-100ul |
SAB |
100ul |
EUR 252 |
GAPDH Rabbit Polyclonal Antibody |
37985-50ul |
SAB |
50ul |
EUR 187 |
EFHD1 Rabbit Polyclonal Antibody |
38001-100ul |
SAB |
100ul |
EUR 252 |
EFHD1 Rabbit Polyclonal Antibody |
38001-50ul |
SAB |
50ul |
EUR 187 |
Alliinase Rabbit Polyclonal Antibody |
38042-100ul |
SAB |
100ul |
EUR 252 |
Alliinase Rabbit Polyclonal Antibody |
38042-50ul |
SAB |
50ul |
EUR 187 |
ECFP Rabbit Polyclonal Antibody |
38077-100ul |
SAB |
100ul |
EUR 252 |
ECFP Rabbit Polyclonal Antibody |
38077-50ul |
SAB |
50ul |
EUR 187 |
EYFP Rabbit Polyclonal Antibody |
38078-100ul |
SAB |
100ul |
EUR 252 |
EYFP Rabbit Polyclonal Antibody |
38078-50ul |
SAB |
50ul |
EUR 187 |
mOrange Rabbit Polyclonal Antibody |
38079-100ul |
SAB |
100ul |
EUR 252 |
mOrange Rabbit Polyclonal Antibody |
38079-50ul |
SAB |
50ul |
EUR 187 |
mStrawberry Rabbit Polyclonal Antibody |
38083-100ul |
SAB |
100ul |
EUR 252 |
mStrawberry Rabbit Polyclonal Antibody |
38083-50ul |
SAB |
50ul |
EUR 187 |
AmCyan Rabbit Polyclonal Antibody |
38086-100ul |
SAB |
100ul |
EUR 252 |
AmCyan Rabbit Polyclonal Antibody |
38086-50ul |
SAB |
50ul |
EUR 187 |
EBFP Rabbit Polyclonal Antibody |
38087-100ul |
SAB |
100ul |
EUR 252 |
EBFP Rabbit Polyclonal Antibody |
38087-50ul |
SAB |
50ul |
EUR 187 |
Vimentin Rabbit Polyclonal Antibody |
38104-100ul |
SAB |
100ul |
EUR 252 |
Vimentin Rabbit Polyclonal Antibody |
38104-50ul |
SAB |
50ul |
EUR 187 |
LDHD Rabbit Polyclonal Antibody |
38105-100ul |
SAB |
100ul |
EUR 252 |
LDHD Rabbit Polyclonal Antibody |
38105-50ul |
SAB |
50ul |
EUR 187 |
GAPDH Rabbit Polyclonal Antibody |
A01021-005ml |
Abbkine |
0.05ml |
EUR 147 |
- Immunogen information: Recombinant Protein
- Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
- Show more
|
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein |
GAPDH Rabbit Polyclonal Antibody |
A01021-02ml |
Abbkine |
0.2ml |
EUR 332 |
- Immunogen information: Recombinant Protein
- Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
- Show more
|
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein |
GAPDH Rabbit Polyclonal Antibody |
A01021-02ml5 |
Abbkine |
0.2ml×5 |
EUR 920 |
- Immunogen information: Recombinant Protein
- Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
- Show more
|
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein |
Rabbit Hemoglobin Polyclonal Antibody |
A53073 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: The best epigenetics products |
Met Rabbit Polyclonal Antibody |
ABP57458-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
Met Rabbit Polyclonal Antibody |
ABP57458-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
Met Rabbit Polyclonal Antibody |
ABP57458-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
VEGF Rabbit Polyclonal Antibody |
ABP57460-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
VEGF Rabbit Polyclonal Antibody |
ABP57460-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
VEGF Rabbit Polyclonal Antibody |
ABP57460-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
CD10 Rabbit Polyclonal Antibody |
ABP57461-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of CD10 of MME
- Applications tips:
|
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME |
CD10 Rabbit Polyclonal Antibody |
ABP57461-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of CD10 of MME
- Applications tips:
|
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME |
CD10 Rabbit Polyclonal Antibody |
ABP57461-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of CD10 of MME
- Applications tips:
|
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME |
NM23A Rabbit Polyclonal Antibody |
ABP57462-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of NM23A of NME1
- Applications tips:
|
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1 |
NM23A Rabbit Polyclonal Antibody |
ABP57462-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of NM23A of NME1
- Applications tips:
|
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1 |
NM23A Rabbit Polyclonal Antibody |
ABP57462-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of NM23A of NME1
- Applications tips:
|
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1 |
ATM Rabbit Polyclonal Antibody |
ABP57463-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
ATM Rabbit Polyclonal Antibody |
ABP57463-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
ATM Rabbit Polyclonal Antibody |
ABP57463-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
ATM Rabbit Polyclonal Antibody |
ABP57464-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
ATM Rabbit Polyclonal Antibody |
ABP57464-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
PCBP2 Rabbit Polyclonal Antibody