PCBP2 Rabbit Polyclonal Antibody

PCBP2 Rabbit Polyclonal Antibody

To Order: garrett@bioworldantibodies.com

PCBP2 Polyclonal Antibody

ES9065-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against PCBP2 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

PCBP2 Rabbit pAb

A2531-100ul 100 ul
EUR 308

PCBP2 Rabbit pAb

A2531-200ul 200 ul
EUR 459

PCBP2 Rabbit pAb

A2531-20ul 20 ul
EUR 183

PCBP2 Rabbit pAb

A2531-50ul 50 ul
EUR 223

PCBP2 antibody

22117-100ul 100ul
EUR 390

PCBP2 antibody

70R-19135 50 ul
EUR 435
Description: Rabbit polyclonal PCBP2 antibody

PCBP2 antibody

70R-13182 100 ul
EUR 457
Description: Affinity purified Rabbit polyclonal PCBP2 antibody

PCBP2 antibody

70R-13611 100 ul
EUR 457
Description: Affinity purified Rabbit polyclonal PCBP2 antibody

PCBP2 antibody

70R-1378 100 ug
EUR 377
Description: Rabbit polyclonal PCBP2 antibody

PCBP2 antibody

70R-1465 100 ug
EUR 377
Description: Rabbit polyclonal PCBP2 antibody

PCBP2 Antibody

32696-100ul 100ul
EUR 252

PCBP2 Antibody

1-CSB-PA622995LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PCBP2. Recognizes PCBP2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:500-1:5000, IHC:1:200-1:500

PCBP2 Antibody

DF6991 200ul
EUR 304
Description: PCBP2 Antibody detects endogenous levels of total PCBP2.

PCBP2 Antibody

1-CSB-PA017517GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against PCBP2. Recognizes PCBP2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

PCBP2 Antibody

ABD6991 100 ug
EUR 438

PCBP2 Conjugated Antibody

C32696 100ul
EUR 397

anti- PCBP2 antibody

FNab06191 100µg
EUR 505.25
  • Recommended dilution: WB: 1:1000 - 1:2000
  • IHC: 1:50 - 1:200
  • Immunogen: poly(rC) binding protein 2
  • Uniprot ID: Q15366
  • Gene ID: 5094
  • Research Area: Immunology, Metabolism
Description: Antibody raised against PCBP2

Anti-PCBP2 antibody

PAab06191 100 ug
EUR 355

Anti-PCBP2 antibody

STJ24914 100 µl
EUR 277
Description: The protein encoded by this gene appears to be multifunctional. Along with PCBP-1 and hnRNPK, it is one of the major cellular poly(rC)-binding proteins. The encoded protein contains three K-homologous (KH) domains which may be involved in RNA binding. Together with PCBP-1, this protein also functions as a translational coactivator of poliovirus RNA via a sequence-specific interaction with stem-loop IV of the IRES, promoting poliovirus RNA replication by binding to its 5'-terminal cloverleaf structure. It has also been implicated in translational control of the 15-lipoxygenase mRNA, human papillomavirus type 16 L2 mRNA, and hepatitis A virus RNA. The encoded protein is also suggested to play a part in formation of a sequence-specific alpha-globin mRNP complex which is associated with alpha-globin mRNA stability. This multiexon structural mRNA is thought to be retrotransposed to generate PCBP-1, an intronless gene with functions similar to that of PCBP2. This gene and PCBP-1 have paralogous genes (PCBP3 and PCBP4) which are thought to have arisen as a result of duplication events of entire genes. Thsi gene also has two processed pseudogenes (PCBP2P1 and PCBP2P2). Multiple transcript variants encoding different isoforms have been found for this gene.

Anti-PCBP2 antibody

STJ190223 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to PCBP2

PCBP2 siRNA

20-abx927849
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

PCBP2 siRNA

20-abx927850
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

anti-PCBP2

YF-PA13628 100 ul
EUR 403
Description: Rabbit polyclonal to PCBP2

PCBP2 Antibody, HRP conjugated

1-CSB-PA622995LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PCBP2. Recognizes PCBP2 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

PCBP2 Antibody, FITC conjugated

1-CSB-PA622995LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PCBP2. Recognizes PCBP2 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

PCBP2 Antibody, Biotin conjugated

1-CSB-PA622995LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PCBP2. Recognizes PCBP2 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

PCBP2 Blocking Peptide

33R-4463 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of PCBP2 antibody, catalog no. 70R-1465

PCBP2 Blocking Peptide

33R-9591 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of PCBP2 antibody, catalog no. 70R-1378

PCBP2 Blocking Peptide

DF6991-BP 1mg
EUR 195

PCBP2 cloning plasmid

CSB-CL622995HU1-10ug 10ug
EUR 415
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1089
  • Sequence: atggacaccggtgtgattgaaggtggattaaatgtcactctcaccatccggctacttatgcatggaaaggaagttggcagtatcatcggaaagaaaggagaatcagttaagaagatgcgcgaggagagtggtgcacgtatcaacatctcagaagggaattgtcctgagagaatta
  • Show more
Description: A cloning plasmid for the PCBP2 gene.

PCBP2 cloning plasmid

CSB-CL622995HU2-10ug 10ug
EUR 418
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1101
  • Sequence: atggacaccggtgtgattgaaggtggattaaatgtcactctcaccatccggctacttatgcatggaaaggaagttggcagtatcatcggaaagaaaggagaatcagttaagaagatgcgcgaggagagtggtgcacgtatcaacatctcagaagggaattgtcctgagagaatta
  • Show more
Description: A cloning plasmid for the PCBP2 gene.

Anti-PCBP2 (5F12)

YF-MA10666 100 ug
EUR 363
Description: Mouse monoclonal to PCBP2

PCBP2 ELISA KIT|Human

EF001592 96 Tests
EUR 689

Mouse PCBP2 shRNA Plasmid

20-abx971941
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human PCBP2 shRNA Plasmid

20-abx953388
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

PCBP2 Recombinant Protein (Human)

RP022663 100 ug Ask for price

PCBP2 Recombinant Protein (Human)

RP022666 100 ug Ask for price

PCBP2 Recombinant Protein (Mouse)

RP160352 100 ug Ask for price

PCBP2 Recombinant Protein (Mouse)

RP160355 100 ug Ask for price

PCBP2 Recombinant Protein (Mouse)

RP160358 100 ug Ask for price

PCBP2 Recombinant Protein (Mouse)

RP160361 100 ug Ask for price

PCBP2 Recombinant Protein (Rat)

RP219440 100 ug Ask for price

Monoclonal PCBP2 Antibody (monoclonal) (M07), Clone: 5F12

APG02955G 0.1mg
EUR 484
Description: A Monoclonal antibody against Human PCBP2 (monoclonal) (M07). The antibodies are raised in mouse and are from clone 5F12. This antibody is applicable in WB, IHC and IF, E

Monoclonal PCBP2 Antibody (monoclonal) (M02), Clone: 1B6

APR10965G 0.1mg
EUR 484
Description: A Monoclonal antibody against Human PCBP2 (monoclonal) (M02). The antibodies are raised in mouse and are from clone 1B6. This antibody is applicable in WB, E

Poly(Rc) Binding Protein 2 (PCBP2) Antibody

20-abx114578
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Poly(RC) Binding Protein 2 (PCBP2) Antibody

abx236191-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

Poly(RC) Binding Protein 2 (PCBP2) Antibody

20-abx338495
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Poly(RC) Binding Protein 2 (PCBP2) Antibody

20-abx001971
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Pcbp2 ORF Vector (Rat) (pORF)

ORF073148 1.0 ug DNA
EUR 506

h PCBP2 inducible lentiviral particles

LVP278 1x107 IFU/ml x 200ul
EUR 451
Description: Pre-made tet-inducible lentiviral particles expressing a human gene with a Blasticidin-RFP fusion marker (Dual selection). The expressed human gene, PCBP2, is fully sequence verified and matched to NCBI accession ID: NM_031989.4

PCBP2 ORF Vector (Human) (pORF)

ORF007555 1.0 ug DNA
EUR 95

PCBP2 ORF Vector (Human) (pORF)

ORF007556 1.0 ug DNA
EUR 95

Pcbp2 ORF Vector (Mouse) (pORF)

ORF053452 1.0 ug DNA
EUR 506

Pcbp2 ORF Vector (Mouse) (pORF)

ORF053453 1.0 ug DNA
EUR 506

Pcbp2 ORF Vector (Mouse) (pORF)

ORF053454 1.0 ug DNA
EUR 506

Pcbp2 ORF Vector (Mouse) (pORF)

ORF053455 1.0 ug DNA
EUR 506

Anti-PCBP2/hnRNP E2 (1B6)

YF-MA14610 100 ug
EUR 363
Description: Mouse monoclonal to PCBP2/hnRNP E2

Anti-PCBP2/hnRNP E2 (3A1)

YF-MA14611 100 ug
EUR 363
Description: Mouse monoclonal to PCBP2/hnRNP E2

Anti-PCBP2/hnRNP E2 (1C7)

YF-MA14612 100 ug
EUR 363
Description: Mouse monoclonal to PCBP2/hnRNP E2

Anti-PCBP2/hnRNP E2 (6B6)

YF-MA14613 100 ug
EUR 363
Description: Mouse monoclonal to PCBP2/hnRNP E2

Anti-PCBP2/hnRNP E2 (6E9)

YF-MA14614 100 ug
EUR 363
Description: Mouse monoclonal to PCBP2/hnRNP E2

Poly(RC) Binding Protein 2 (PCBP2) Antibody (HRP)

20-abx337084
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Poly(RC) Binding Protein 2 (PCBP2) Antibody (FITC)

20-abx337085
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Poly(RC) Binding Protein 2 (PCBP2) Antibody (Biotin)

20-abx337086
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Pcbp2 sgRNA CRISPR Lentivector set (Mouse)

K4799401 3 x 1.0 ug
EUR 339

Pcbp2 sgRNA CRISPR Lentivector set (Rat)

K6494301 3 x 1.0 ug
EUR 339

PCBP2 sgRNA CRISPR Lentivector set (Human)

K1601201 3 x 1.0 ug
EUR 339

Monoclonal HNRNP-E2 / PCBP2 Antibody (clone 5F12), Clone: 5F12

AMM05385G 0.05mg
EUR 528
Description: A Monoclonal antibody against Human HNRNP-E2 / PCBP2 (clone 5F12). The antibodies are raised in Mouse and are from clone 5F12. This antibody is applicable in WB and IHC-P, IF, E, RNAi

Pcbp2 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4799402 1.0 ug DNA
EUR 154

Pcbp2 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4799403 1.0 ug DNA
EUR 154

Pcbp2 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4799404 1.0 ug DNA
EUR 154

Pcbp2 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6494302 1.0 ug DNA
EUR 154

Pcbp2 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6494303 1.0 ug DNA
EUR 154

Pcbp2 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6494304 1.0 ug DNA
EUR 154

PCBP2 sgRNA CRISPR Lentivector (Human) (Target 1)

K1601202 1.0 ug DNA
EUR 154

PCBP2 sgRNA CRISPR Lentivector (Human) (Target 2)

K1601203 1.0 ug DNA
EUR 154

PCBP2 sgRNA CRISPR Lentivector (Human) (Target 3)

K1601204 1.0 ug DNA
EUR 154

PCBP2 Protein Vector (Rat) (pPB-C-His)

PV292590 500 ng
EUR 603

PCBP2 Protein Vector (Rat) (pPB-N-His)

PV292591 500 ng
EUR 603

PCBP2 Protein Vector (Rat) (pPM-C-HA)

PV292592 500 ng
EUR 603

PCBP2 Protein Vector (Rat) (pPM-C-His)

PV292593 500 ng
EUR 603

PCBP2 Protein Vector (Mouse) (pPB-C-His)

PV213806 500 ng
EUR 603

PCBP2 Protein Vector (Mouse) (pPB-N-His)

PV213807 500 ng
EUR 603

PCBP2 Protein Vector (Mouse) (pPM-C-HA)

PV213808 500 ng
EUR 603

PCBP2 Protein Vector (Mouse) (pPM-C-His)

PV213809 500 ng
EUR 603

PCBP2 Protein Vector (Mouse) (pPB-C-His)

PV213810 500 ng
EUR 603

PCBP2 Protein Vector (Mouse) (pPB-N-His)

PV213811 500 ng
EUR 603

PCBP2 Protein Vector (Mouse) (pPM-C-HA)

PV213812 500 ng
EUR 603

PCBP2 Protein Vector (Mouse) (pPM-C-His)

PV213813 500 ng
EUR 603

PCBP2 Protein Vector (Mouse) (pPB-C-His)

PV213814 500 ng
EUR 603

PCBP2 Protein Vector (Mouse) (pPB-N-His)

PV213815 500 ng
EUR 603

PCBP2 Protein Vector (Mouse) (pPM-C-HA)

PV213816 500 ng
EUR 603

PCBP2 Protein Vector (Mouse) (pPM-C-His)

PV213817 500 ng
EUR 603

PCBP2 Protein Vector (Mouse) (pPB-C-His)

PV213818 500 ng
EUR 603

PCBP2 Protein Vector (Mouse) (pPB-N-His)

PV213819 500 ng
EUR 603

PCBP2 Protein Vector (Mouse) (pPM-C-HA)

PV213820 500 ng
EUR 603

PCBP2 Protein Vector (Mouse) (pPM-C-His)

PV213821 500 ng
EUR 603

PCBP2 Protein Vector (Human) (pPB-C-His)

PV030217 500 ng
EUR 329

PCBP2 Protein Vector (Human) (pPB-N-His)

PV030218 500 ng
EUR 329

PCBP2 Protein Vector (Human) (pPM-C-HA)

PV030219 500 ng
EUR 329

PCBP2 Protein Vector (Human) (pPM-C-His)

PV030220 500 ng
EUR 329

PCBP2 Protein Vector (Human) (pPB-C-His)

PV030221 500 ng
EUR 329

PCBP2 Protein Vector (Human) (pPB-N-His)

PV030222 500 ng
EUR 329

PCBP2 Protein Vector (Human) (pPM-C-HA)

PV030223 500 ng
EUR 329

PCBP2 Protein Vector (Human) (pPM-C-His)

PV030224 500 ng
EUR 329

Pcbp2 3'UTR Luciferase Stable Cell Line

TU115962 1.0 ml Ask for price

Pcbp2 3'UTR GFP Stable Cell Line

TU165962 1.0 ml Ask for price

Pcbp2 3'UTR Luciferase Stable Cell Line

TU215860 1.0 ml Ask for price

Pcbp2 3'UTR GFP Stable Cell Line

TU265860 1.0 ml Ask for price

PCBP2 3'UTR GFP Stable Cell Line

TU067465 1.0 ml
EUR 1521

PCBP2 3'UTR Luciferase Stable Cell Line

TU017465 1.0 ml
EUR 1521

PCBP2 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV)

LV713127 1.0 ug DNA
EUR 316

PCBP2 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV713131 1.0 ug DNA
EUR 316

PCBP2 Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a)

LV713132 1.0 ug DNA
EUR 316

PCBP2 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV669355 1.0 ug DNA
EUR 682

PCBP2 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV669359 1.0 ug DNA
EUR 682

PCBP2 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV669360 1.0 ug DNA
EUR 682

GAPDH Rabbit Polyclonal Antibody

37985-100ul 100ul
EUR 252

GAPDH Rabbit Polyclonal Antibody

37985-50ul 50ul
EUR 187

EFHD1 Rabbit Polyclonal Antibody

38001-100ul 100ul
EUR 252

EFHD1 Rabbit Polyclonal Antibody

38001-50ul 50ul
EUR 187

Alliinase Rabbit Polyclonal Antibody

38042-100ul 100ul
EUR 252

Alliinase Rabbit Polyclonal Antibody

38042-50ul 50ul
EUR 187

ECFP Rabbit Polyclonal Antibody

38077-100ul 100ul
EUR 252

ECFP Rabbit Polyclonal Antibody

38077-50ul 50ul
EUR 187

EYFP Rabbit Polyclonal Antibody

38078-100ul 100ul
EUR 252

EYFP Rabbit Polyclonal Antibody

38078-50ul 50ul
EUR 187

mOrange Rabbit Polyclonal Antibody

38079-100ul 100ul
EUR 252

mOrange Rabbit Polyclonal Antibody

38079-50ul 50ul
EUR 187

mStrawberry Rabbit Polyclonal Antibody

38083-100ul 100ul
EUR 252

mStrawberry Rabbit Polyclonal Antibody

38083-50ul 50ul
EUR 187

AmCyan Rabbit Polyclonal Antibody

38086-100ul 100ul
EUR 252

AmCyan Rabbit Polyclonal Antibody

38086-50ul 50ul
EUR 187

EBFP Rabbit Polyclonal Antibody

38087-100ul 100ul
EUR 252

EBFP Rabbit Polyclonal Antibody

38087-50ul 50ul
EUR 187

Vimentin Rabbit Polyclonal Antibody

38104-100ul 100ul
EUR 252

Vimentin Rabbit Polyclonal Antibody

38104-50ul 50ul
EUR 187

LDHD Rabbit Polyclonal Antibody

38105-100ul 100ul
EUR 252

LDHD Rabbit Polyclonal Antibody

38105-50ul 50ul
EUR 187

GAPDH Rabbit Polyclonal Antibody

A01021-005ml 0.05ml
EUR 147
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

GAPDH Rabbit Polyclonal Antibody

A01021-02ml 0.2ml
EUR 332
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

GAPDH Rabbit Polyclonal Antibody

A01021-02ml5 0.2ml×5
EUR 920
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

Rabbit Hemoglobin Polyclonal Antibody

A53073 100 µg
EUR 570.55
Description: The best epigenetics products

Met Rabbit Polyclonal Antibody

ABP57458-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody

ABP57458-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody

ABP57458-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

VEGF Rabbit Polyclonal Antibody

ABP57460-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

VEGF Rabbit Polyclonal Antibody

ABP57460-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

VEGF Rabbit Polyclonal Antibody

ABP57460-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

CD10 Rabbit Polyclonal Antibody

ABP57461-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

CD10 Rabbit Polyclonal Antibody

ABP57461-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

CD10 Rabbit Polyclonal Antibody

ABP57461-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

NM23A Rabbit Polyclonal Antibody

ABP57462-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

NM23A Rabbit Polyclonal Antibody

ABP57462-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

NM23A Rabbit Polyclonal Antibody

ABP57462-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

ATM Rabbit Polyclonal Antibody

ABP57463-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody

ABP57463-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody

ABP57463-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody

ABP57464-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody

ABP57464-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

PCBP2 Rabbit Polyclonal Antibody

Back To Top