PDE3A Rabbit Polyclonal Antibody
To Order: garrett@bioworldantibodies.com
PDE3A Polyclonal Antibody |
ABP59862-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human PDE3A protein at amino acid sequence of 250-330
- Applications tips:
|
Description: A polyclonal antibody for detection of PDE3A from Human, Mouse, Rat. This PDE3A antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PDE3A protein at amino acid sequence of 250-330 |
PDE3A Polyclonal Antibody |
30227-100ul |
SAB |
100ul |
EUR 252 |
PDE3A Polyclonal Antibody |
30227-50ul |
SAB |
50ul |
EUR 187 |
PDE3A Rabbit pAb |
A17919-100ul |
Abclonal |
100 ul |
EUR 308 |
PDE3A Rabbit pAb |
A17919-200ul |
Abclonal |
200 ul |
EUR 459 |
PDE3A Rabbit pAb |
A17919-20ul |
Abclonal |
20 ul |
EUR 183 |
PDE3A Rabbit pAb |
A17919-50ul |
Abclonal |
50 ul |
EUR 223 |
PDE3A Polyclonal Conjugated Antibody |
C30227 |
SAB |
100ul |
EUR 397 |
Human Phosphodiesterase 3A, cGMP Inhibited (PDE3A) ELISA Kit |
DLR-PDE3A-Hu-48T |
DL Develop |
48T |
EUR 517 |
- Should the Human Phosphodiesterase 3A, cGMP Inhibited (PDE3A) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Phosphodiesterase 3A, cGMP Inhibited (PDE3A) in samples from tissue homogenates or other biological fluids. |
Human Phosphodiesterase 3A, cGMP Inhibited (PDE3A) ELISA Kit |
DLR-PDE3A-Hu-96T |
DL Develop |
96T |
EUR 673 |
- Should the Human Phosphodiesterase 3A, cGMP Inhibited (PDE3A) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Phosphodiesterase 3A, cGMP Inhibited (PDE3A) in samples from tissue homogenates or other biological fluids. |
Mouse Phosphodiesterase 3A, cGMP Inhibited (PDE3A) ELISA Kit |
DLR-PDE3A-Mu-48T |
DL Develop |
48T |
EUR 527 |
- Should the Mouse Phosphodiesterase 3A, cGMP Inhibited (PDE3A) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Phosphodiesterase 3A, cGMP Inhibited (PDE3A) in samples from tissue homogenates or other biological fluids. |
Mouse Phosphodiesterase 3A, cGMP Inhibited (PDE3A) ELISA Kit |
DLR-PDE3A-Mu-96T |
DL Develop |
96T |
EUR 688 |
- Should the Mouse Phosphodiesterase 3A, cGMP Inhibited (PDE3A) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Phosphodiesterase 3A, cGMP Inhibited (PDE3A) in samples from tissue homogenates or other biological fluids. |
Rat Phosphodiesterase 3A, cGMP Inhibited (PDE3A) ELISA Kit |
DLR-PDE3A-Ra-48T |
DL Develop |
48T |
EUR 549 |
- Should the Rat Phosphodiesterase 3A, cGMP Inhibited (PDE3A) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Rat Phosphodiesterase 3A, cGMP Inhibited (PDE3A) in samples from tissue homogenates or other biological fluids. |
Rat Phosphodiesterase 3A, cGMP Inhibited (PDE3A) ELISA Kit |
DLR-PDE3A-Ra-96T |
DL Develop |
96T |
EUR 718 |
- Should the Rat Phosphodiesterase 3A, cGMP Inhibited (PDE3A) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Rat Phosphodiesterase 3A, cGMP Inhibited (PDE3A) in samples from tissue homogenates or other biological fluids. |
Human Phosphodiesterase 3A, cGMP Inhibited (PDE3A) ELISA Kit |
RD-PDE3A-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 521 |
Human Phosphodiesterase 3A, cGMP Inhibited (PDE3A) ELISA Kit |
RD-PDE3A-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 723 |
Mouse Phosphodiesterase 3A, cGMP Inhibited (PDE3A) ELISA Kit |
RD-PDE3A-Mu-48Tests |
Reddot Biotech |
48 Tests |
EUR 533 |
Mouse Phosphodiesterase 3A, cGMP Inhibited (PDE3A) ELISA Kit |
RD-PDE3A-Mu-96Tests |
Reddot Biotech |
96 Tests |
EUR 740 |
Rat Phosphodiesterase 3A, cGMP Inhibited (PDE3A) ELISA Kit |
RD-PDE3A-Ra-48Tests |
Reddot Biotech |
48 Tests |
EUR 557 |
Rat Phosphodiesterase 3A, cGMP Inhibited (PDE3A) ELISA Kit |
RD-PDE3A-Ra-96Tests |
Reddot Biotech |
96 Tests |
EUR 775 |
Human Phosphodiesterase 3A, cGMP Inhibited (PDE3A) ELISA Kit |
RDR-PDE3A-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 544 |
Human Phosphodiesterase 3A, cGMP Inhibited (PDE3A) ELISA Kit |
RDR-PDE3A-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 756 |
Mouse Phosphodiesterase 3A, cGMP Inhibited (PDE3A) ELISA Kit |
RDR-PDE3A-Mu-48Tests |
Reddot Biotech |
48 Tests |
EUR 557 |
Mouse Phosphodiesterase 3A, cGMP Inhibited (PDE3A) ELISA Kit |
RDR-PDE3A-Mu-96Tests |
Reddot Biotech |
96 Tests |
EUR 774 |
Rat Phosphodiesterase 3A, cGMP Inhibited (PDE3A) ELISA Kit |
RDR-PDE3A-Ra-48Tests |
Reddot Biotech |
48 Tests |
EUR 583 |
Rat Phosphodiesterase 3A, cGMP Inhibited (PDE3A) ELISA Kit |
RDR-PDE3A-Ra-96Tests |
Reddot Biotech |
96 Tests |
EUR 811 |
PDE3A antibody |
70R-6279 |
Fitzgerald |
50 ug |
EUR 467 |
Description: Rabbit polyclonal PDE3A antibody raised against the N terminal of PDE3A |
PDE3A Antibody |
39579-100ul |
SAB |
100ul |
EUR 390 |
PDE3A antibody |
20R-PR083 |
Fitzgerald |
50 ug |
EUR 656 |
Description: Rabbit polyclonal PDE3A antibody |
PDE3A antibody |
20R-PR084 |
Fitzgerald |
50 ug |
EUR 656 |
Description: Rabbit polyclonal PDE3A antibody |
PDE3A antibody |
20R-PR090 |
Fitzgerald |
50 ug |
EUR 656 |
Description: Rabbit polyclonal PDE3A antibody |
PDE3A Antibody |
DF9371 |
Affbiotech |
200ul |
EUR 304 |
Description: PDE3A Antibody detects endogenous levels of total PDE3A. |
Polyclonal PDE3A Antibody (N-Terminus) |
AMM07053G |
Leading Biology |
0.05mg |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human PDE3A (N-Terminus). This antibody is tested and proven to work in the following applications: |
Polyclonal PDE3A Antibody (N-Terminus) |
AMM07054G |
Leading Biology |
0.05mg |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human PDE3A (N-Terminus). This antibody is tested and proven to work in the following applications: |
PDE3A (Phospho-Ser312) Polyclonal Conjugated Antibody |
C12773 |
SAB |
100ul |
EUR 397 |
PDE3A (pS312) Antibody |
abx217677-100ug |
Abbexa |
100 ug |
EUR 439 |
- Shipped within 5-10 working days.
|
Anti-PDE3A antibody |
STJ119906 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: This gene encodes a member of the cGMP-inhibited cyclic nucleotide phosphodiesterase (cGI-PDE) family. cGI-PDE enzymes hydrolyze both cAMP and cGMP, and play critical roles in many cellular processes by regulating the amplitude and duration of intracellular cyclic nucleotide signals. The encoded protein mediates platelet aggregation and also plays important roles in cardiovascular function by regulating vascular smooth muscle contraction and relaxation. Inhibitors of the encoded protein may be effective in treating congestive heart failure. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. |
Anti-PDE3A antibody |
STJ190165 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to PDE3A |
PDE3A siRNA |
20-abx903894 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
PDE3A siRNA |
20-abx928071 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
PDE3A siRNA |
20-abx928072 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
anti-PDE3A |
YF-PA24325 |
Abfrontier |
50 ul |
EUR 334 |
Description: Mouse polyclonal to PDE3A |
Phospho-PDE3A (Ser312) Antibody |
AF8501 |
Affbiotech |
200ul |
EUR 376 |
Description: PDE3A (Phospho-Ser312) Antibody detects endogenous levels of PDE3A only when phosphorylated at Ser312. |
PDE3A (Phospho-Ser312) Antibody |
12773-100ul |
SAB |
100ul |
EUR 252 |
PDE3A (Phospho-Ser312) Antibody |
12773-50ul |
SAB |
50ul |
EUR 187 |
PDE3A cloning plasmid |
CSB-CL614528HU-10ug |
Cusabio |
10ug |
EUR 1217 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 3426
- Sequence: atggcagtgcccggcgacgctgcacgagtcagggacaagcccgtccacagtggggtgagtcaagcccccacggcgggccgggactgccaccatcgtgcggaccccgcatcgccgcgggactcgggctgccgtggctgctggggagacctggtgctgcagccgctccggagctctc
- Show more
|
Description: A cloning plasmid for the PDE3A gene. |
PDE3A Blocking Peptide |
33R-5115 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of PDE3A antibody, catalog no. 70R-6279 |
PDE3A Blocking Peptide |
DF9371-BP |
Affbiotech |
1mg |
EUR 195 |
Recombinant human PDE3A |
P1146 |
FN Test |
100ug |
Ask for price |
- Uniprot ID: Q14432
- Reconstitution: Metal affinity chromatography on Fn Super Capacity Column (Nickel)
|
Description: Recombinant protein for human PDE3A |
Anti-PDE3A (5C12) |
YF-MA14638 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to PDE3A |
Anti-PDE3A (2D7) |
YF-MA14639 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to PDE3A |
Phosphodiesterase 3A, CGMP Inhibited (PDE3A) Antibody |
abx037224-100ug |
Abbexa |
100 ug |
EUR 391 |
- Shipped within 5-10 working days.
|
Phosphodiesterase 3A, cGMP Inhibited (PDE3A) Antibody |
20-abx174024 |
Abbexa |
|
|
|
Phosphodiesterase 3A, cGMP Inhibited (PDE3A) Antibody |
20-abx177987 |
Abbexa |
-
EUR 453.00
-
EUR 133.00
-
EUR 1302.00
-
EUR 620.00
-
EUR 342.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Mouse PDE3A shRNA Plasmid |
20-abx974523 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Rat PDE3A shRNA Plasmid |
20-abx985753 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Human PDE3A shRNA Plasmid |
20-abx953419 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Monoclonal PDE3A Antibody (monoclonal) (M01), Clone: 5C12 |
AMM07052G |
Leading Biology |
0.1mg |
EUR 484 |
Description: A Monoclonal antibody against Human PDE3A (monoclonal) (M01). The antibodies are raised in mouse and are from clone 5C12. This antibody is applicable in WB, E |
Phospho-PDE3A (Ser312) Blocking Peptide |
AF8501-BP |
Affbiotech |
1mg |
EUR 195 |
Pde3a ORF Vector (Rat) (pORF) |
ORF073261 |
ABM |
1.0 ug DNA |
EUR 506 |
PDE3A ORF Vector (Human) (pORF) |
ORF014043 |
ABM |
1.0 ug DNA |
EUR 95 |
Pde3a ORF Vector (Mouse) (pORF) |
ORF053644 |
ABM |
1.0 ug DNA |
EUR 506 |
PDE3A ELISA Kit (Rat) (OKCD01263) |
OKCD01263 |
Aviva Systems Biology |
96 Wells |
EUR 896 |
Description: Description of target: Cyclic nucleotide phosphodiesterase with a dual-specificity for the second messengers cAMP and cGMP, which are key regulators of many important physiological processes.By similarity ;Species reactivity: Rat;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.27 ng/mL. |
PDE3A sgRNA CRISPR Lentivector set (Human) |
K1617801 |
ABM |
3 x 1.0 ug |
EUR 339 |
Pde3a sgRNA CRISPR Lentivector set (Mouse) |
K5032501 |
ABM |
3 x 1.0 ug |
EUR 339 |
Pde3a sgRNA CRISPR Lentivector set (Rat) |
K6880501 |
ABM |
3 x 1.0 ug |
EUR 339 |
Recombinant Phosphodiesterase 3A, cGMP Inhibited (PDE3A) |
4-RPF639Ra01 |
Cloud-Clone |
-
EUR 458.40
-
EUR 226.00
-
EUR 1444.00
-
EUR 548.00
-
EUR 996.00
-
EUR 370.00
-
EUR 3460.00
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: Q62865
- Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 51.9kDa
- Isoelectric Point: Inquire
|
Description: Recombinant Rat Phosphodiesterase 3A, cGMP Inhibited expressed in: E.coli |
Rat Phosphodiesterase 3A, cGMP Inhibited (PDE3A) Protein |
20-abx650669 |
Abbexa |
-
EUR 648.00
-
EUR 272.00
-
EUR 1943.00
-
EUR 759.00
-
EUR 467.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
PDE3A sgRNA CRISPR Lentivector (Human) (Target 1) |
K1617802 |
ABM |
1.0 ug DNA |
EUR 154 |
PDE3A sgRNA CRISPR Lentivector (Human) (Target 2) |
K1617803 |
ABM |
1.0 ug DNA |
EUR 154 |
PDE3A sgRNA CRISPR Lentivector (Human) (Target 3) |
K1617804 |
ABM |
1.0 ug DNA |
EUR 154 |
Pde3a sgRNA CRISPR Lentivector (Mouse) (Target 1) |
K5032502 |
ABM |
1.0 ug DNA |
EUR 154 |
Pde3a sgRNA CRISPR Lentivector (Mouse) (Target 2) |
K5032503 |
ABM |
1.0 ug DNA |
EUR 154 |
Pde3a sgRNA CRISPR Lentivector (Mouse) (Target 3) |
K5032504 |
ABM |
1.0 ug DNA |
EUR 154 |
Pde3a sgRNA CRISPR Lentivector (Rat) (Target 1) |
K6880502 |
ABM |
1.0 ug DNA |
EUR 154 |
Pde3a sgRNA CRISPR Lentivector (Rat) (Target 2) |
K6880503 |
ABM |
1.0 ug DNA |
EUR 154 |
Pde3a sgRNA CRISPR Lentivector (Rat) (Target 3) |
K6880504 |
ABM |
1.0 ug DNA |
EUR 154 |
PDE3A Protein Vector (Human) (pPB-C-His) |
PV056169 |
ABM |
500 ng |
EUR 481 |
PDE3A Protein Vector (Human) (pPB-N-His) |
PV056170 |
ABM |
500 ng |
EUR 481 |
PDE3A Protein Vector (Human) (pPM-C-HA) |
PV056171 |
ABM |
500 ng |
EUR 481 |
PDE3A Protein Vector (Human) (pPM-C-His) |
PV056172 |
ABM |
500 ng |
EUR 481 |
PDE3A Protein Vector (Mouse) (pPB-C-His) |
PV214574 |
ABM |
500 ng |
EUR 1065 |
PDE3A Protein Vector (Mouse) (pPB-N-His) |
PV214575 |
ABM |
500 ng |
EUR 1065 |
PDE3A Protein Vector (Mouse) (pPM-C-HA) |
PV214576 |
ABM |
500 ng |
EUR 1065 |
PDE3A Protein Vector (Mouse) (pPM-C-His) |
PV214577 |
ABM |
500 ng |
EUR 1065 |
PDE3A Protein Vector (Rat) (pPB-C-His) |
PV293042 |
ABM |
500 ng |
EUR 1166 |
PDE3A Protein Vector (Rat) (pPB-N-His) |
PV293043 |
ABM |
500 ng |
EUR 1166 |
PDE3A Protein Vector (Rat) (pPM-C-HA) |
PV293044 |
ABM |
500 ng |
EUR 1166 |
PDE3A Protein Vector (Rat) (pPM-C-His) |
PV293045 |
ABM |
500 ng |
EUR 1166 |
Pde3a 3'UTR GFP Stable Cell Line |
TU166102 |
ABM |
1.0 ml |
Ask for price |
PDE3A 3'UTR Luciferase Stable Cell Line |
TU017630 |
ABM |
1.0 ml |
EUR 1394 |
PDE3A Rabbit Polyclonal Antibody