PDE3A Rabbit Polyclonal Antibody

PDE3A Rabbit Polyclonal Antibody

To Order: garrett@bioworldantibodies.com

PDE3A Polyclonal Antibody

ABP59862-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human PDE3A protein at amino acid sequence of 250-330
  • Applications tips:
Description: A polyclonal antibody for detection of PDE3A from Human, Mouse, Rat. This PDE3A antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PDE3A protein at amino acid sequence of 250-330

PDE3A Polyclonal Antibody

30227-100ul 100ul
EUR 252

PDE3A Polyclonal Antibody

30227-50ul 50ul
EUR 187

PDE3A Rabbit pAb

A17919-100ul 100 ul
EUR 308

PDE3A Rabbit pAb

A17919-200ul 200 ul
EUR 459

PDE3A Rabbit pAb

A17919-20ul 20 ul
EUR 183

PDE3A Rabbit pAb

A17919-50ul 50 ul
EUR 223

PDE3A Polyclonal Conjugated Antibody

C30227 100ul
EUR 397

Human Phosphodiesterase 3A, cGMP Inhibited (PDE3A) ELISA Kit

DLR-PDE3A-Hu-48T 48T
EUR 517
  • Should the Human Phosphodiesterase 3A, cGMP Inhibited (PDE3A) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Phosphodiesterase 3A, cGMP Inhibited (PDE3A) in samples from tissue homogenates or other biological fluids.

Human Phosphodiesterase 3A, cGMP Inhibited (PDE3A) ELISA Kit

DLR-PDE3A-Hu-96T 96T
EUR 673
  • Should the Human Phosphodiesterase 3A, cGMP Inhibited (PDE3A) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Phosphodiesterase 3A, cGMP Inhibited (PDE3A) in samples from tissue homogenates or other biological fluids.

Mouse Phosphodiesterase 3A, cGMP Inhibited (PDE3A) ELISA Kit

DLR-PDE3A-Mu-48T 48T
EUR 527
  • Should the Mouse Phosphodiesterase 3A, cGMP Inhibited (PDE3A) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Phosphodiesterase 3A, cGMP Inhibited (PDE3A) in samples from tissue homogenates or other biological fluids.

Mouse Phosphodiesterase 3A, cGMP Inhibited (PDE3A) ELISA Kit

DLR-PDE3A-Mu-96T 96T
EUR 688
  • Should the Mouse Phosphodiesterase 3A, cGMP Inhibited (PDE3A) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Phosphodiesterase 3A, cGMP Inhibited (PDE3A) in samples from tissue homogenates or other biological fluids.

Rat Phosphodiesterase 3A, cGMP Inhibited (PDE3A) ELISA Kit

DLR-PDE3A-Ra-48T 48T
EUR 549
  • Should the Rat Phosphodiesterase 3A, cGMP Inhibited (PDE3A) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Phosphodiesterase 3A, cGMP Inhibited (PDE3A) in samples from tissue homogenates or other biological fluids.

Rat Phosphodiesterase 3A, cGMP Inhibited (PDE3A) ELISA Kit

DLR-PDE3A-Ra-96T 96T
EUR 718
  • Should the Rat Phosphodiesterase 3A, cGMP Inhibited (PDE3A) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Phosphodiesterase 3A, cGMP Inhibited (PDE3A) in samples from tissue homogenates or other biological fluids.

Human Phosphodiesterase 3A, cGMP Inhibited (PDE3A) ELISA Kit

RD-PDE3A-Hu-48Tests 48 Tests
EUR 521

Human Phosphodiesterase 3A, cGMP Inhibited (PDE3A) ELISA Kit

RD-PDE3A-Hu-96Tests 96 Tests
EUR 723

Mouse Phosphodiesterase 3A, cGMP Inhibited (PDE3A) ELISA Kit

RD-PDE3A-Mu-48Tests 48 Tests
EUR 533

Mouse Phosphodiesterase 3A, cGMP Inhibited (PDE3A) ELISA Kit

RD-PDE3A-Mu-96Tests 96 Tests
EUR 740

Rat Phosphodiesterase 3A, cGMP Inhibited (PDE3A) ELISA Kit

RD-PDE3A-Ra-48Tests 48 Tests
EUR 557

Rat Phosphodiesterase 3A, cGMP Inhibited (PDE3A) ELISA Kit

RD-PDE3A-Ra-96Tests 96 Tests
EUR 775

Human Phosphodiesterase 3A, cGMP Inhibited (PDE3A) ELISA Kit

RDR-PDE3A-Hu-48Tests 48 Tests
EUR 544

Human Phosphodiesterase 3A, cGMP Inhibited (PDE3A) ELISA Kit

RDR-PDE3A-Hu-96Tests 96 Tests
EUR 756

Mouse Phosphodiesterase 3A, cGMP Inhibited (PDE3A) ELISA Kit

RDR-PDE3A-Mu-48Tests 48 Tests
EUR 557

Mouse Phosphodiesterase 3A, cGMP Inhibited (PDE3A) ELISA Kit

RDR-PDE3A-Mu-96Tests 96 Tests
EUR 774

Rat Phosphodiesterase 3A, cGMP Inhibited (PDE3A) ELISA Kit

RDR-PDE3A-Ra-48Tests 48 Tests
EUR 583

Rat Phosphodiesterase 3A, cGMP Inhibited (PDE3A) ELISA Kit

RDR-PDE3A-Ra-96Tests 96 Tests
EUR 811

PDE3A Antibody

ABD9371 100 ug
EUR 438

PDE3A antibody

70R-6279 50 ug
EUR 467
Description: Rabbit polyclonal PDE3A antibody raised against the N terminal of PDE3A

PDE3A Antibody

39579-100ul 100ul
EUR 390

PDE3A antibody

20R-PR083 50 ug
EUR 656
Description: Rabbit polyclonal PDE3A antibody

PDE3A antibody

20R-PR084 50 ug
EUR 656
Description: Rabbit polyclonal PDE3A antibody

PDE3A antibody

20R-PR090 50 ug
EUR 656
Description: Rabbit polyclonal PDE3A antibody

PDE3A Antibody

DF9371 200ul
EUR 304
Description: PDE3A Antibody detects endogenous levels of total PDE3A.

Polyclonal PDE3A Antibody (N-Terminus)

AMM07053G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human PDE3A (N-Terminus). This antibody is tested and proven to work in the following applications:

Polyclonal PDE3A Antibody (N-Terminus)

AMM07054G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human PDE3A (N-Terminus). This antibody is tested and proven to work in the following applications:

PDE3A (Phospho-Ser312) Polyclonal Conjugated Antibody

C12773 100ul
EUR 397

PDE3A (pS312) Antibody

abx217677-100ug 100 ug
EUR 439
  • Shipped within 5-10 working days.

Anti-PDE3A Antibody

STJ502262 100 µg
EUR 515

Anti-PDE3A Antibody

STJ502263 100 µg
EUR 515

Anti-PDE3A antibody

STJ119906 100 µl
EUR 277
Description: This gene encodes a member of the cGMP-inhibited cyclic nucleotide phosphodiesterase (cGI-PDE) family. cGI-PDE enzymes hydrolyze both cAMP and cGMP, and play critical roles in many cellular processes by regulating the amplitude and duration of intracellular cyclic nucleotide signals. The encoded protein mediates platelet aggregation and also plays important roles in cardiovascular function by regulating vascular smooth muscle contraction and relaxation. Inhibitors of the encoded protein may be effective in treating congestive heart failure. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene.

Anti-PDE3A antibody

STJ190165 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to PDE3A


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


YF-PA24325 50 ul
EUR 334
Description: Mouse polyclonal to PDE3A

Phospho-PDE3A (Ser312) Antibody

AF8501 200ul
EUR 376
Description: PDE3A (Phospho-Ser312) Antibody detects endogenous levels of PDE3A only when phosphorylated at Ser312.

PDE3A (Phospho- Ser312) Antibody

ABF8501 100 ug
EUR 438

PDE3A (Phospho-Ser312) Antibody

12773-100ul 100ul
EUR 252

PDE3A (Phospho-Ser312) Antibody

12773-50ul 50ul
EUR 187

Anti-PDE3A Antibody (Biotin)

STJ502264 100 µg
EUR 586

Anti-PDE3A Antibody (FITC)

STJ502265 100 µg
EUR 586

Anti-PDE3A Antibody (Biotin)

STJ502266 100 µg
EUR 586

Anti-PDE3A Antibody (FITC)

STJ502267 100 µg
EUR 586

Anti-Phospho-PDE3A Antibody

STJ502603 100 µg
EUR 586

PDE3A cloning plasmid

CSB-CL614528HU-10ug 10ug
EUR 1217
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 3426
  • Sequence: atggcagtgcccggcgacgctgcacgagtcagggacaagcccgtccacagtggggtgagtcaagcccccacggcgggccgggactgccaccatcgtgcggaccccgcatcgccgcgggactcgggctgccgtggctgctggggagacctggtgctgcagccgctccggagctctc
  • Show more
Description: A cloning plasmid for the PDE3A gene.

PDE3A Blocking Peptide

33R-5115 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of PDE3A antibody, catalog no. 70R-6279

PDE3A Blocking Peptide

DF9371-BP 1mg
EUR 195

Recombinant human PDE3A

P1146 100ug Ask for price
  • Uniprot ID: Q14432
  • Reconstitution: Metal affinity chromatography on Fn Super Capacity Column (Nickel)
Description: Recombinant protein for human PDE3A

pDONR223-PDE3A Plasmid

PVTB01077-1 2 ug
EUR 356

Anti-PDE3A (5C12)

YF-MA14638 100 ug
EUR 363
Description: Mouse monoclonal to PDE3A

Anti-PDE3A (2D7)

YF-MA14639 100 ug
EUR 363
Description: Mouse monoclonal to PDE3A

Anti-Phospho-PDE3A Antibody BIOTIN

STJ502604 100 µg
EUR 645

Anti-Phospho-PDE3A Antibody FITC

STJ502605 100 µg
EUR 645

Phosphodiesterase 3A, CGMP Inhibited (PDE3A) Antibody

abx037224-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Phosphodiesterase 3A, cGMP Inhibited (PDE3A) Antibody

  • EUR 913.00
  • EUR 467.00
  • 1 mg
  • 200 ug
  • Please enquire.

Phosphodiesterase 3A, cGMP Inhibited (PDE3A) Antibody

  • EUR 453.00
  • EUR 133.00
  • EUR 1302.00
  • EUR 620.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Mouse PDE3A shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Rat PDE3A shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human PDE3A shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Monoclonal PDE3A Antibody (monoclonal) (M01), Clone: 5C12

AMM07052G 0.1mg
EUR 484
Description: A Monoclonal antibody against Human PDE3A (monoclonal) (M01). The antibodies are raised in mouse and are from clone 5C12. This antibody is applicable in WB, E

Phospho-PDE3A (Ser312) Blocking Peptide

AF8501-BP 1mg
EUR 195

Pde3a ORF Vector (Rat) (pORF)

ORF073261 1.0 ug DNA
EUR 506

PDE3A ORF Vector (Human) (pORF)

ORF014043 1.0 ug DNA
EUR 95

Pde3a ORF Vector (Mouse) (pORF)

ORF053644 1.0 ug DNA
EUR 506

PDE3A ELISA Kit (Rat) (OKCD01263)

OKCD01263 96 Wells
EUR 896
Description: Description of target: Cyclic nucleotide phosphodiesterase with a dual-specificity for the second messengers cAMP and cGMP, which are key regulators of many important physiological processes.By similarity ;Species reactivity: Rat;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.27 ng/mL.

PDE3A sgRNA CRISPR Lentivector set (Human)

K1617801 3 x 1.0 ug
EUR 339

Pde3a sgRNA CRISPR Lentivector set (Mouse)

K5032501 3 x 1.0 ug
EUR 339

Pde3a sgRNA CRISPR Lentivector set (Rat)

K6880501 3 x 1.0 ug
EUR 339

Recombinant Phosphodiesterase 3A, cGMP Inhibited (PDE3A)

  • EUR 458.40
  • EUR 226.00
  • EUR 1444.00
  • EUR 548.00
  • EUR 996.00
  • EUR 370.00
  • EUR 3460.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q62865
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 51.9kDa
  • Isoelectric Point: Inquire
Description: Recombinant Rat Phosphodiesterase 3A, cGMP Inhibited expressed in: E.coli

Rat Phosphodiesterase 3A, cGMP Inhibited (PDE3A) Protein

  • EUR 648.00
  • EUR 272.00
  • EUR 1943.00
  • EUR 759.00
  • EUR 467.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

PDE3A sgRNA CRISPR Lentivector (Human) (Target 1)

K1617802 1.0 ug DNA
EUR 154

PDE3A sgRNA CRISPR Lentivector (Human) (Target 2)

K1617803 1.0 ug DNA
EUR 154

PDE3A sgRNA CRISPR Lentivector (Human) (Target 3)

K1617804 1.0 ug DNA
EUR 154

Pde3a sgRNA CRISPR Lentivector (Mouse) (Target 1)

K5032502 1.0 ug DNA
EUR 154

Pde3a sgRNA CRISPR Lentivector (Mouse) (Target 2)

K5032503 1.0 ug DNA
EUR 154

Pde3a sgRNA CRISPR Lentivector (Mouse) (Target 3)

K5032504 1.0 ug DNA
EUR 154

Pde3a sgRNA CRISPR Lentivector (Rat) (Target 1)

K6880502 1.0 ug DNA
EUR 154

Pde3a sgRNA CRISPR Lentivector (Rat) (Target 2)

K6880503 1.0 ug DNA
EUR 154

Pde3a sgRNA CRISPR Lentivector (Rat) (Target 3)

K6880504 1.0 ug DNA
EUR 154

PDE3A Protein Vector (Human) (pPB-C-His)

PV056169 500 ng
EUR 481

PDE3A Protein Vector (Human) (pPB-N-His)

PV056170 500 ng
EUR 481

PDE3A Protein Vector (Human) (pPM-C-HA)

PV056171 500 ng
EUR 481

PDE3A Protein Vector (Human) (pPM-C-His)

PV056172 500 ng
EUR 481

PDE3A Protein Vector (Mouse) (pPB-C-His)

PV214574 500 ng
EUR 1065

PDE3A Protein Vector (Mouse) (pPB-N-His)

PV214575 500 ng
EUR 1065

PDE3A Protein Vector (Mouse) (pPM-C-HA)

PV214576 500 ng
EUR 1065

PDE3A Protein Vector (Mouse) (pPM-C-His)

PV214577 500 ng
EUR 1065

PDE3A Protein Vector (Rat) (pPB-C-His)

PV293042 500 ng
EUR 1166

PDE3A Protein Vector (Rat) (pPB-N-His)

PV293043 500 ng
EUR 1166

PDE3A Protein Vector (Rat) (pPM-C-HA)

PV293044 500 ng
EUR 1166

PDE3A Protein Vector (Rat) (pPM-C-His)

PV293045 500 ng
EUR 1166

Pde3a 3'UTR GFP Stable Cell Line

TU166102 1.0 ml Ask for price

PDE3A 3'UTR Luciferase Stable Cell Line

TU017630 1.0 ml
EUR 1394

PDE3A Rabbit Polyclonal Antibody

Back To Top