PKN1 Rabbit Polyclonal Antibody

PKN1 Rabbit Polyclonal Antibody

To Order: garrett@bioworldantibodies.com

PKN1 Polyclonal Antibody
ES8989-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against PKN1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

Human Protein Kinase N1 (PKN1) ELISA Kit
DLR-PKN1-Hu-48T 48T
EUR 479
  • Should the Human Protein Kinase N1 (PKN1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Protein Kinase N1 (PKN1) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Protein Kinase N1 (PKN1) ELISA Kit
DLR-PKN1-Hu-96T 96T
EUR 621
  • Should the Human Protein Kinase N1 (PKN1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Protein Kinase N1 (PKN1) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Protein Kinase N1 (PKN1) ELISA Kit
RDR-PKN1-Hu-48Tests 48 Tests
EUR 500

Human Protein Kinase N1 (PKN1) ELISA Kit
RDR-PKN1-Hu-96Tests 96 Tests
EUR 692

Human Protein Kinase N1 (PKN1) ELISA Kit
RD-PKN1-Hu-48Tests 48 Tests
EUR 478

Human Protein Kinase N1 (PKN1) ELISA Kit
RD-PKN1-Hu-96Tests 96 Tests
EUR 662

PKN1 Rabbit pAb
A0553-100ul 100 ul
EUR 308

PKN1 Rabbit pAb
A0553-200ul 200 ul
EUR 459

PKN1 Rabbit pAb
A0553-20ul 20 ul
EUR 183

PKN1 Rabbit pAb
A0553-50ul 50 ul
EUR 223

PKN1 Antibody
48392-100ul 100ul
EUR 333

PKN1 Antibody
48392-50ul 50ul
EUR 239

PKN1 Antibody
DF4790 200ul
EUR 304
Description: PKN1 Antibody detects endogenous levels of total PKN1.

PKN1 Antibody
1-CSB-PA030259
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against PKN1. Recognizes PKN1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/20000

PKN1 antibody
70R-50256 100 ul
EUR 244
Description: Purified Polyclonal PKN1 antibody

PKN1 Antibody
ABD4790 100 ug
EUR 438

Rabbit PKN1 ELISA Kit
ERTP0125 96Tests
EUR 521

PKN1/PRK1 Antibody
35295-100ul 100ul
EUR 252

PKN1/PRK1 Antibody
35295-50ul 50ul
EUR 187

PKN1 Conjugated Antibody
C48392 100ul
EUR 397

Anti-PKN1 antibody
STJ110991 100 µl
EUR 277
Description: The protein encoded by this gene belongs to the protein kinase C superfamily. This kinase is activated by Rho family of small G proteins and may mediate the Rho-dependent signaling pathway. This kinase can be activated by phospholipids and by limited proteolysis. The 3-phosphoinositide dependent protein kinase-1 (PDPK1/PDK1) is reported to phosphorylate this kinase, which may mediate insulin signals to the actin cytoskeleton. The proteolytic activation of this kinase by caspase-3 or related proteases during apoptosis suggests its role in signal transduction related to apoptosis. Alternatively spliced transcript variants encoding distinct isoforms have been observed.

Anti-PKN1 antibody
STJ190147 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to PKN1

Pkn1/ Rat Pkn1 ELISA Kit
ELI-37289r 96 Tests
EUR 886

Protein Kinase N1 (PKN1) Polyclonal Antibody (Human)
4-PAA501Hu01
  • EUR 232.00
  • EUR 2272.00
  • EUR 571.00
  • EUR 288.00
  • EUR 207.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PKN1 (Phe615~Phe874)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Protein Kinase N1 (PKN1)

PKN1 siRNA
20-abx904045
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

PKN1 siRNA
20-abx928745
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

PKN1 siRNA
20-abx928746
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

anti-PKN1
YF-PA13997 50 ug
EUR 363
Description: Mouse polyclonal to PKN1

anti-PKN1
YF-PA13998 100 ug
EUR 403
Description: Rabbit polyclonal to PKN1

anti-PKN1
YF-PA27338 100 ul
EUR 403
Description: Rabbit polyclonal to PKN1

PKN1/PRK1 Conjugated Antibody
C35295 100ul
EUR 397

Protein Kinase N1 (PKN1) Polyclonal Antibody (Human), APC
4-PAA501Hu01-APC
  • EUR 323.00
  • EUR 2951.00
  • EUR 831.00
  • EUR 407.00
  • EUR 209.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PKN1 (Phe615~Phe874)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Protein Kinase N1 (PKN1). This antibody is labeled with APC.

Protein Kinase N1 (PKN1) Polyclonal Antibody (Human), Biotinylated
4-PAA501Hu01-Biotin
  • EUR 295.00
  • EUR 2222.00
  • EUR 668.00
  • EUR 357.00
  • EUR 212.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PKN1 (Phe615~Phe874)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Protein Kinase N1 (PKN1). This antibody is labeled with Biotin.

Protein Kinase N1 (PKN1) Polyclonal Antibody (Human), Cy3
4-PAA501Hu01-Cy3
  • EUR 389.00
  • EUR 3893.00
  • EUR 1067.00
  • EUR 501.00
  • EUR 237.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PKN1 (Phe615~Phe874)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Protein Kinase N1 (PKN1). This antibody is labeled with Cy3.

Protein Kinase N1 (PKN1) Polyclonal Antibody (Human), FITC
4-PAA501Hu01-FITC
  • EUR 278.00
  • EUR 2380.00
  • EUR 685.00
  • EUR 346.00
  • EUR 187.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PKN1 (Phe615~Phe874)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Protein Kinase N1 (PKN1). This antibody is labeled with FITC.

Protein Kinase N1 (PKN1) Polyclonal Antibody (Human), HRP
4-PAA501Hu01-HRP
  • EUR 296.00
  • EUR 2574.00
  • EUR 737.00
  • EUR 369.00
  • EUR 198.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PKN1 (Phe615~Phe874)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Protein Kinase N1 (PKN1). This antibody is labeled with HRP.

Protein Kinase N1 (PKN1) Polyclonal Antibody (Human), PE
4-PAA501Hu01-PE
  • EUR 278.00
  • EUR 2380.00
  • EUR 685.00
  • EUR 346.00
  • EUR 187.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PKN1 (Phe615~Phe874)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Protein Kinase N1 (PKN1). This antibody is labeled with PE.

Rabbit Protein Kinase N1 (PKN1) ELISA Kit
abx362392-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

PKN1 Blocking Peptide
DF4790-BP 1mg
EUR 195

PKN1 Blocking Peptide
20-abx063131
  • EUR 272.00
  • EUR 411.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

PKN1 cloning plasmid
CSB-CL623082HU-10ug 10ug
EUR 902
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2829
  • Sequence: atggccagcgacgccgtgcagagtgagcctcgcagctggtccctgctagagcagctgggcctggccggggcagacctggcggcccccggggtacagcagcagctggagctggagcgggagcggctgcggcgggaaatccgcaaggagctgaagctgaaggagggtgctgagaacc
  • Show more
Description: A cloning plasmid for the PKN1 gene.

Anti-PKN1 (1B10)
YF-MA14890 100 ug
EUR 363
Description: Mouse monoclonal to PKN1

Anti-PKN1 (1A4)
YF-MA14891 100 ug
EUR 363
Description: Mouse monoclonal to PKN1

Protein Kinase N1 (PKN1) Antibody
20-abx008827
  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

Protein Kinase N1 (PKN1) Antibody
20-abx101658
  • EUR 300.00
  • EUR 133.00
  • EUR 746.00
  • EUR 398.00
  • EUR 258.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Protein Kinase N1 (PKN1) Antibody
20-abx135704
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Protein Kinase N1 (PKN1) Antibody
20-abx174267
  • EUR 787.00
  • EUR 411.00
  • 1 mg
  • 200 ug
  • Please enquire.

Monoclonal PKN1 Antibody, Clone: EPR3238
AMM07214G 0.1ml
EUR 528
Description: A Monoclonal antibody against Human PKN1. The antibodies are raised in Rabbit and are from clone EPR3238. This antibody is applicable in WB, FC

Monoclonal PKN1 Antibody, Clone: 4H10B1
AMM03009G 0.1ml
EUR 528
Description: A Monoclonal antibody against Human PKN1. The antibodies are raised in Mouse and are from clone 4H10B1. This antibody is applicable in WB and IHC, FC, ICC, E

Antibody for Human PKN1 (pThr774)
SPC-1065D 0.1ml
EUR 354
Description: A polyclonal antibody for PKN1 (pThr774) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Thr774 of human PKN1 (AA771-777). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This PKN1 (pThr774) antibody is unconjugated.

Antibody for Human PKN1 (pThr774)
SPC-1065D-A390 0.1ml
EUR 401
Description: A polyclonal antibody for PKN1 (pThr774) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Thr774 of human PKN1 (AA771-777). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This PKN1 (pThr774) antibody is conjugated to ATTO 390.

Antibody for Human PKN1 (pThr774)
SPC-1065D-A488 0.1ml
EUR 400
Description: A polyclonal antibody for PKN1 (pThr774) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Thr774 of human PKN1 (AA771-777). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This PKN1 (pThr774) antibody is conjugated to ATTO 488.

Antibody for Human PKN1 (pThr774)
SPC-1065D-A565 0.1ml
EUR 400
Description: A polyclonal antibody for PKN1 (pThr774) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Thr774 of human PKN1 (AA771-777). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This PKN1 (pThr774) antibody is conjugated to ATTO 565.

Antibody for Human PKN1 (pThr774)
SPC-1065D-A594 0.1ml
EUR 400
Description: A polyclonal antibody for PKN1 (pThr774) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Thr774 of human PKN1 (AA771-777). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This PKN1 (pThr774) antibody is conjugated to ATTO 594.

Antibody for Human PKN1 (pThr774)
SPC-1065D-A633 0.1ml
EUR 400
Description: A polyclonal antibody for PKN1 (pThr774) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Thr774 of human PKN1 (AA771-777). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This PKN1 (pThr774) antibody is conjugated to ATTO 633.

Antibody for Human PKN1 (pThr774)
SPC-1065D-A655 0.1ml
EUR 400
Description: A polyclonal antibody for PKN1 (pThr774) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Thr774 of human PKN1 (AA771-777). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This PKN1 (pThr774) antibody is conjugated to ATTO 655.

Antibody for Human PKN1 (pThr774)
SPC-1065D-A680 0.1ml
EUR 400
Description: A polyclonal antibody for PKN1 (pThr774) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Thr774 of human PKN1 (AA771-777). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This PKN1 (pThr774) antibody is conjugated to ATTO 680.

Antibody for Human PKN1 (pThr774)
SPC-1065D-A700 0.1ml
EUR 400
Description: A polyclonal antibody for PKN1 (pThr774) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Thr774 of human PKN1 (AA771-777). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This PKN1 (pThr774) antibody is conjugated to ATTO 700.

Antibody for Human PKN1 (pThr774)
SPC-1065D-ALP 0.1ml
EUR 394
Description: A polyclonal antibody for PKN1 (pThr774) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Thr774 of human PKN1 (AA771-777). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This PKN1 (pThr774) antibody is conjugated to Alkaline Phosphatase.

Antibody for Human PKN1 (pThr774)
SPC-1065D-APC 0.1ml
EUR 399
Description: A polyclonal antibody for PKN1 (pThr774) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Thr774 of human PKN1 (AA771-777). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This PKN1 (pThr774) antibody is conjugated to APC .

Antibody for Human PKN1 (pThr774)
SPC-1065D-APCCY7 0.1ml
EUR 471
Description: A polyclonal antibody for PKN1 (pThr774) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Thr774 of human PKN1 (AA771-777). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This PKN1 (pThr774) antibody is conjugated to APC/Cy7.

Antibody for Human PKN1 (pThr774)
SPC-1065D-BI 0.1ml
EUR 396
Description: A polyclonal antibody for PKN1 (pThr774) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Thr774 of human PKN1 (AA771-777). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This PKN1 (pThr774) antibody is conjugated to Biotin.

Antibody for Human PKN1 (pThr774)
SPC-1065D-DY350 0.1ml
EUR 475
Description: A polyclonal antibody for PKN1 (pThr774) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Thr774 of human PKN1 (AA771-777). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This PKN1 (pThr774) antibody is conjugated to Dylight 350.

Antibody for Human PKN1 (pThr774)
SPC-1065D-DY405 0.1ml
EUR 452
Description: A polyclonal antibody for PKN1 (pThr774) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Thr774 of human PKN1 (AA771-777). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This PKN1 (pThr774) antibody is conjugated to Dylight 405.

Antibody for Human PKN1 (pThr774)
SPC-1065D-DY488 0.1ml
EUR 432
Description: A polyclonal antibody for PKN1 (pThr774) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Thr774 of human PKN1 (AA771-777). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This PKN1 (pThr774) antibody is conjugated to Dylight 488.

Antibody for Human PKN1 (pThr774)
SPC-1065D-DY594 0.1ml
EUR 436
Description: A polyclonal antibody for PKN1 (pThr774) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Thr774 of human PKN1 (AA771-777). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This PKN1 (pThr774) antibody is conjugated to Dylight 594.

Antibody for Human PKN1 (pThr774)
SPC-1065D-DY633 0.1ml
EUR 426
Description: A polyclonal antibody for PKN1 (pThr774) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Thr774 of human PKN1 (AA771-777). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This PKN1 (pThr774) antibody is conjugated to Dylight 633.

Antibody for Human PKN1 (pThr774)
SPC-1065D-FITC 0.1ml
EUR 392
Description: A polyclonal antibody for PKN1 (pThr774) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Thr774 of human PKN1 (AA771-777). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This PKN1 (pThr774) antibody is conjugated to FITC.

Antibody for Human PKN1 (pThr774)
SPC-1065D-HRP 0.1ml
EUR 388
Description: A polyclonal antibody for PKN1 (pThr774) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Thr774 of human PKN1 (AA771-777). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This PKN1 (pThr774) antibody is conjugated to HRP.

Antibody for Human PKN1 (pThr774)
SPC-1065D-P594 0.1ml
EUR 407
Description: A polyclonal antibody for PKN1 (pThr774) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Thr774 of human PKN1 (AA771-777). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This PKN1 (pThr774) antibody is conjugated to PE/ATTO 594.

Antibody for Human PKN1 (pThr774)
SPC-1065D-PCP 0.1ml
EUR 399
Description: A polyclonal antibody for PKN1 (pThr774) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Thr774 of human PKN1 (AA771-777). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This PKN1 (pThr774) antibody is conjugated to PerCP.

Antibody for Human PKN1 (pThr774)
SPC-1065D-RPE 0.1ml
EUR 397
Description: A polyclonal antibody for PKN1 (pThr774) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Thr774 of human PKN1 (AA771-777). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This PKN1 (pThr774) antibody is conjugated to RPE .

Antibody for Human PKN1 (pThr774)
SPC-1065D-STR 0.1ml
EUR 398
Description: A polyclonal antibody for PKN1 (pThr774) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Thr774 of human PKN1 (AA771-777). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This PKN1 (pThr774) antibody is conjugated to Streptavidin.

Protein Kinase N1 (PKN1) Polyclonal Antibody (Human), APC-Cy7
4-PAA501Hu01-APC-Cy7
  • EUR 526.00
  • EUR 5782.00
  • EUR 1543.00
  • EUR 695.00
  • EUR 299.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PKN1 (Phe615~Phe874)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Protein Kinase N1 (PKN1). This antibody is labeled with APC-Cy7.

Human PKN1 ELISA Kit
EHP0125 96Tests
EUR 521

Bovine PKN1 ELISA Kit
EBP0125 96Tests
EUR 521

Anserini PKN1 ELISA Kit
EAP0125 96Tests
EUR 521

Canine PKN1 ELISA Kit
ECP0125 96Tests
EUR 521

Goat PKN1 ELISA Kit
EGTP0125 96Tests
EUR 521

PKN1 ELISA KIT|Human
EF005461 96 Tests
EUR 689

Rat PKN1 shRNA Plasmid
20-abx985442
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human PKN1 shRNA Plasmid
20-abx953755
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse PKN1 shRNA Plasmid
20-abx983453
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Porcine PKN1 ELISA Kit
EPP0125 96Tests
EUR 521

PKN1 Rabbit Polyclonal Antibody

Back To Top