PKN1 Rabbit Polyclonal Antibody
To Order: garrett@bioworldantibodies.com
PKN1 Polyclonal Antibody |
ES8989-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against PKN1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA |
Human Protein Kinase N1 (PKN1) ELISA Kit |
DLR-PKN1-Hu-48T |
DL Develop |
48T |
EUR 479 |
- Should the Human Protein Kinase N1 (PKN1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Protein Kinase N1 (PKN1) in samples from tissue homogenates, cell lysates or other biological fluids. |
Human Protein Kinase N1 (PKN1) ELISA Kit |
DLR-PKN1-Hu-96T |
DL Develop |
96T |
EUR 621 |
- Should the Human Protein Kinase N1 (PKN1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Protein Kinase N1 (PKN1) in samples from tissue homogenates, cell lysates or other biological fluids. |
Human Protein Kinase N1 (PKN1) ELISA Kit |
RDR-PKN1-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 500 |
Human Protein Kinase N1 (PKN1) ELISA Kit |
RDR-PKN1-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 692 |
Human Protein Kinase N1 (PKN1) ELISA Kit |
RD-PKN1-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 478 |
Human Protein Kinase N1 (PKN1) ELISA Kit |
RD-PKN1-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 662 |
PKN1 Rabbit pAb |
A0553-100ul |
Abclonal |
100 ul |
EUR 308 |
PKN1 Rabbit pAb |
A0553-200ul |
Abclonal |
200 ul |
EUR 459 |
PKN1 Rabbit pAb |
A0553-20ul |
Abclonal |
20 ul |
EUR 183 |
PKN1 Rabbit pAb |
A0553-50ul |
Abclonal |
50 ul |
EUR 223 |
PKN1 Antibody |
48392-100ul |
SAB |
100ul |
EUR 333 |
PKN1 Antibody |
48392-50ul |
SAB |
50ul |
EUR 239 |
PKN1 Antibody |
DF4790 |
Affbiotech |
200ul |
EUR 304 |
Description: PKN1 Antibody detects endogenous levels of total PKN1. |
PKN1 Antibody |
1-CSB-PA030259 |
Cusabio |
|
|
- Form: Liquid
- Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
|
Description: A polyclonal antibody against PKN1. Recognizes PKN1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/20000 |
PKN1 antibody |
70R-50256 |
Fitzgerald |
100 ul |
EUR 244 |
Description: Purified Polyclonal PKN1 antibody |
Rabbit PKN1 ELISA Kit |
ERTP0125 |
Abclonal |
96Tests |
EUR 521 |
PKN1/PRK1 Antibody |
35295-100ul |
SAB |
100ul |
EUR 252 |
PKN1/PRK1 Antibody |
35295-50ul |
SAB |
50ul |
EUR 187 |
PKN1 Conjugated Antibody |
C48392 |
SAB |
100ul |
EUR 397 |
Anti-PKN1 antibody |
STJ110991 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: The protein encoded by this gene belongs to the protein kinase C superfamily. This kinase is activated by Rho family of small G proteins and may mediate the Rho-dependent signaling pathway. This kinase can be activated by phospholipids and by limited proteolysis. The 3-phosphoinositide dependent protein kinase-1 (PDPK1/PDK1) is reported to phosphorylate this kinase, which may mediate insulin signals to the actin cytoskeleton. The proteolytic activation of this kinase by caspase-3 or related proteases during apoptosis suggests its role in signal transduction related to apoptosis. Alternatively spliced transcript variants encoding distinct isoforms have been observed. |
Anti-PKN1 antibody |
STJ190147 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to PKN1 |
Protein Kinase N1 (PKN1) Polyclonal Antibody (Human) |
4-PAA501Hu01 |
Cloud-Clone |
-
EUR 232.00
-
EUR 2272.00
-
EUR 571.00
-
EUR 288.00
-
EUR 207.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: PKN1 (Phe615~Phe874)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Protein Kinase N1 (PKN1) |
PKN1 siRNA |
20-abx904045 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
PKN1 siRNA |
20-abx928745 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
PKN1 siRNA |
20-abx928746 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
anti-PKN1 |
YF-PA13997 |
Abfrontier |
50 ug |
EUR 363 |
Description: Mouse polyclonal to PKN1 |
anti-PKN1 |
YF-PA13998 |
Abfrontier |
100 ug |
EUR 403 |
Description: Rabbit polyclonal to PKN1 |
anti-PKN1 |
YF-PA27338 |
Abfrontier |
100 ul |
EUR 403 |
Description: Rabbit polyclonal to PKN1 |
PKN1/PRK1 Conjugated Antibody |
C35295 |
SAB |
100ul |
EUR 397 |
Protein Kinase N1 (PKN1) Polyclonal Antibody (Human), APC |
4-PAA501Hu01-APC |
Cloud-Clone |
-
EUR 323.00
-
EUR 2951.00
-
EUR 831.00
-
EUR 407.00
-
EUR 209.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: PKN1 (Phe615~Phe874)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Protein Kinase N1 (PKN1). This antibody is labeled with APC. |
Protein Kinase N1 (PKN1) Polyclonal Antibody (Human), Biotinylated |
4-PAA501Hu01-Biotin |
Cloud-Clone |
-
EUR 295.00
-
EUR 2222.00
-
EUR 668.00
-
EUR 357.00
-
EUR 212.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: PKN1 (Phe615~Phe874)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Protein Kinase N1 (PKN1). This antibody is labeled with Biotin. |
Protein Kinase N1 (PKN1) Polyclonal Antibody (Human), Cy3 |
4-PAA501Hu01-Cy3 |
Cloud-Clone |
-
EUR 389.00
-
EUR 3893.00
-
EUR 1067.00
-
EUR 501.00
-
EUR 237.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: PKN1 (Phe615~Phe874)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Protein Kinase N1 (PKN1). This antibody is labeled with Cy3. |
Protein Kinase N1 (PKN1) Polyclonal Antibody (Human), FITC |
4-PAA501Hu01-FITC |
Cloud-Clone |
-
EUR 278.00
-
EUR 2380.00
-
EUR 685.00
-
EUR 346.00
-
EUR 187.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: PKN1 (Phe615~Phe874)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Protein Kinase N1 (PKN1). This antibody is labeled with FITC. |
Protein Kinase N1 (PKN1) Polyclonal Antibody (Human), HRP |
4-PAA501Hu01-HRP |
Cloud-Clone |
-
EUR 296.00
-
EUR 2574.00
-
EUR 737.00
-
EUR 369.00
-
EUR 198.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: PKN1 (Phe615~Phe874)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Protein Kinase N1 (PKN1). This antibody is labeled with HRP. |
Protein Kinase N1 (PKN1) Polyclonal Antibody (Human), PE |
4-PAA501Hu01-PE |
Cloud-Clone |
-
EUR 278.00
-
EUR 2380.00
-
EUR 685.00
-
EUR 346.00
-
EUR 187.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: PKN1 (Phe615~Phe874)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Protein Kinase N1 (PKN1). This antibody is labeled with PE. |
Rabbit Protein Kinase N1 (PKN1) ELISA Kit |
abx362392-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
PKN1 Blocking Peptide |
DF4790-BP |
Affbiotech |
1mg |
EUR 195 |
PKN1 Blocking Peptide |
20-abx063131 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
PKN1 cloning plasmid |
CSB-CL623082HU-10ug |
Cusabio |
10ug |
EUR 902 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 2829
- Sequence: atggccagcgacgccgtgcagagtgagcctcgcagctggtccctgctagagcagctgggcctggccggggcagacctggcggcccccggggtacagcagcagctggagctggagcgggagcggctgcggcgggaaatccgcaaggagctgaagctgaaggagggtgctgagaacc
- Show more
|
Description: A cloning plasmid for the PKN1 gene. |
Anti-PKN1 (1B10) |
YF-MA14890 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to PKN1 |
Anti-PKN1 (1A4) |
YF-MA14891 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to PKN1 |
Protein Kinase N1 (PKN1) Antibody |
20-abx008827 |
Abbexa |
-
EUR 300.00
-
EUR 439.00
-
EUR 189.00
|
|
- Shipped within 5-10 working days.
|
Protein Kinase N1 (PKN1) Antibody |
20-abx101658 |
Abbexa |
-
EUR 300.00
-
EUR 133.00
-
EUR 746.00
-
EUR 398.00
-
EUR 258.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Protein Kinase N1 (PKN1) Antibody |
20-abx135704 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
Protein Kinase N1 (PKN1) Antibody |
20-abx174267 |
Abbexa |
|
|
|
Monoclonal PKN1 Antibody, Clone: EPR3238 |
AMM07214G |
Leading Biology |
0.1ml |
EUR 528 |
Description: A Monoclonal antibody against Human PKN1. The antibodies are raised in Rabbit and are from clone EPR3238. This antibody is applicable in WB, FC |
Monoclonal PKN1 Antibody, Clone: 4H10B1 |
AMM03009G |
Leading Biology |
0.1ml |
EUR 528 |
Description: A Monoclonal antibody against Human PKN1. The antibodies are raised in Mouse and are from clone 4H10B1. This antibody is applicable in WB and IHC, FC, ICC, E |
Antibody for Human PKN1 (pThr774) |
SPC-1065D |
Stressmarq |
0.1ml |
EUR 354 |
Description: A polyclonal antibody for PKN1 (pThr774) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Thr774 of human PKN1 (AA771-777). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This PKN1 (pThr774) antibody is unconjugated. |
Antibody for Human PKN1 (pThr774) |
SPC-1065D-A390 |
Stressmarq |
0.1ml |
EUR 401 |
Description: A polyclonal antibody for PKN1 (pThr774) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Thr774 of human PKN1 (AA771-777). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This PKN1 (pThr774) antibody is conjugated to ATTO 390. |
Antibody for Human PKN1 (pThr774) |
SPC-1065D-A488 |
Stressmarq |
0.1ml |
EUR 400 |
Description: A polyclonal antibody for PKN1 (pThr774) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Thr774 of human PKN1 (AA771-777). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This PKN1 (pThr774) antibody is conjugated to ATTO 488. |
Antibody for Human PKN1 (pThr774) |
SPC-1065D-A565 |
Stressmarq |
0.1ml |
EUR 400 |
Description: A polyclonal antibody for PKN1 (pThr774) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Thr774 of human PKN1 (AA771-777). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This PKN1 (pThr774) antibody is conjugated to ATTO 565. |
Antibody for Human PKN1 (pThr774) |
SPC-1065D-A594 |
Stressmarq |
0.1ml |
EUR 400 |
Description: A polyclonal antibody for PKN1 (pThr774) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Thr774 of human PKN1 (AA771-777). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This PKN1 (pThr774) antibody is conjugated to ATTO 594. |
Antibody for Human PKN1 (pThr774) |
SPC-1065D-A633 |
Stressmarq |
0.1ml |
EUR 400 |
Description: A polyclonal antibody for PKN1 (pThr774) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Thr774 of human PKN1 (AA771-777). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This PKN1 (pThr774) antibody is conjugated to ATTO 633. |
Antibody for Human PKN1 (pThr774) |
SPC-1065D-A655 |
Stressmarq |
0.1ml |
EUR 400 |
Description: A polyclonal antibody for PKN1 (pThr774) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Thr774 of human PKN1 (AA771-777). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This PKN1 (pThr774) antibody is conjugated to ATTO 655. |
Antibody for Human PKN1 (pThr774) |
SPC-1065D-A680 |
Stressmarq |
0.1ml |
EUR 400 |
Description: A polyclonal antibody for PKN1 (pThr774) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Thr774 of human PKN1 (AA771-777). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This PKN1 (pThr774) antibody is conjugated to ATTO 680. |
Antibody for Human PKN1 (pThr774) |
SPC-1065D-A700 |
Stressmarq |
0.1ml |
EUR 400 |
Description: A polyclonal antibody for PKN1 (pThr774) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Thr774 of human PKN1 (AA771-777). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This PKN1 (pThr774) antibody is conjugated to ATTO 700. |
Antibody for Human PKN1 (pThr774) |
SPC-1065D-ALP |
Stressmarq |
0.1ml |
EUR 394 |
Description: A polyclonal antibody for PKN1 (pThr774) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Thr774 of human PKN1 (AA771-777). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This PKN1 (pThr774) antibody is conjugated to Alkaline Phosphatase. |
Antibody for Human PKN1 (pThr774) |
SPC-1065D-APC |
Stressmarq |
0.1ml |
EUR 399 |
Description: A polyclonal antibody for PKN1 (pThr774) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Thr774 of human PKN1 (AA771-777). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This PKN1 (pThr774) antibody is conjugated to APC . |
Antibody for Human PKN1 (pThr774) |
SPC-1065D-APCCY7 |
Stressmarq |
0.1ml |
EUR 471 |
Description: A polyclonal antibody for PKN1 (pThr774) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Thr774 of human PKN1 (AA771-777). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This PKN1 (pThr774) antibody is conjugated to APC/Cy7. |
Antibody for Human PKN1 (pThr774) |
SPC-1065D-BI |
Stressmarq |
0.1ml |
EUR 396 |
Description: A polyclonal antibody for PKN1 (pThr774) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Thr774 of human PKN1 (AA771-777). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This PKN1 (pThr774) antibody is conjugated to Biotin. |
Antibody for Human PKN1 (pThr774) |
SPC-1065D-DY350 |
Stressmarq |
0.1ml |
EUR 475 |
Description: A polyclonal antibody for PKN1 (pThr774) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Thr774 of human PKN1 (AA771-777). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This PKN1 (pThr774) antibody is conjugated to Dylight 350. |
Antibody for Human PKN1 (pThr774) |
SPC-1065D-DY405 |
Stressmarq |
0.1ml |
EUR 452 |
Description: A polyclonal antibody for PKN1 (pThr774) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Thr774 of human PKN1 (AA771-777). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This PKN1 (pThr774) antibody is conjugated to Dylight 405. |
Antibody for Human PKN1 (pThr774) |
SPC-1065D-DY488 |
Stressmarq |
0.1ml |
EUR 432 |
Description: A polyclonal antibody for PKN1 (pThr774) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Thr774 of human PKN1 (AA771-777). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This PKN1 (pThr774) antibody is conjugated to Dylight 488. |
Antibody for Human PKN1 (pThr774) |
SPC-1065D-DY594 |
Stressmarq |
0.1ml |
EUR 436 |
Description: A polyclonal antibody for PKN1 (pThr774) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Thr774 of human PKN1 (AA771-777). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This PKN1 (pThr774) antibody is conjugated to Dylight 594. |
Antibody for Human PKN1 (pThr774) |
SPC-1065D-DY633 |
Stressmarq |
0.1ml |
EUR 426 |
Description: A polyclonal antibody for PKN1 (pThr774) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Thr774 of human PKN1 (AA771-777). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This PKN1 (pThr774) antibody is conjugated to Dylight 633. |
Antibody for Human PKN1 (pThr774) |
SPC-1065D-FITC |
Stressmarq |
0.1ml |
EUR 392 |
Description: A polyclonal antibody for PKN1 (pThr774) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Thr774 of human PKN1 (AA771-777). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This PKN1 (pThr774) antibody is conjugated to FITC. |
Antibody for Human PKN1 (pThr774) |
SPC-1065D-HRP |
Stressmarq |
0.1ml |
EUR 388 |
Description: A polyclonal antibody for PKN1 (pThr774) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Thr774 of human PKN1 (AA771-777). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This PKN1 (pThr774) antibody is conjugated to HRP. |
Antibody for Human PKN1 (pThr774) |
SPC-1065D-P594 |
Stressmarq |
0.1ml |
EUR 407 |
Description: A polyclonal antibody for PKN1 (pThr774) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Thr774 of human PKN1 (AA771-777). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This PKN1 (pThr774) antibody is conjugated to PE/ATTO 594. |
Antibody for Human PKN1 (pThr774) |
SPC-1065D-PCP |
Stressmarq |
0.1ml |
EUR 399 |
Description: A polyclonal antibody for PKN1 (pThr774) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Thr774 of human PKN1 (AA771-777). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This PKN1 (pThr774) antibody is conjugated to PerCP. |
Antibody for Human PKN1 (pThr774) |
SPC-1065D-RPE |
Stressmarq |
0.1ml |
EUR 397 |
Description: A polyclonal antibody for PKN1 (pThr774) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Thr774 of human PKN1 (AA771-777). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This PKN1 (pThr774) antibody is conjugated to RPE . |
Antibody for Human PKN1 (pThr774) |
SPC-1065D-STR |
Stressmarq |
0.1ml |
EUR 398 |
Description: A polyclonal antibody for PKN1 (pThr774) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Thr774 of human PKN1 (AA771-777). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This PKN1 (pThr774) antibody is conjugated to Streptavidin. |
Protein Kinase N1 (PKN1) Polyclonal Antibody (Human), APC-Cy7 |
4-PAA501Hu01-APC-Cy7 |
Cloud-Clone |
-
EUR 526.00
-
EUR 5782.00
-
EUR 1543.00
-
EUR 695.00
-
EUR 299.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: PKN1 (Phe615~Phe874)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Protein Kinase N1 (PKN1). This antibody is labeled with APC-Cy7. |
Human PKN1 ELISA Kit |
EHP0125 |
Abclonal |
96Tests |
EUR 521 |
Bovine PKN1 ELISA Kit |
EBP0125 |
Abclonal |
96Tests |
EUR 521 |
Anserini PKN1 ELISA Kit |
EAP0125 |
Abclonal |
96Tests |
EUR 521 |
Canine PKN1 ELISA Kit |
ECP0125 |
Abclonal |
96Tests |
EUR 521 |
Goat PKN1 ELISA Kit |
EGTP0125 |
Abclonal |
96Tests |
EUR 521 |
Rat PKN1 shRNA Plasmid |
20-abx985442 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Human PKN1 shRNA Plasmid |
20-abx953755 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Mouse PKN1 shRNA Plasmid |
20-abx983453 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Porcine PKN1 ELISA Kit |
EPP0125 |
Abclonal |
96Tests |
EUR 521 |
PKN1 Rabbit Polyclonal Antibody