PMCH Rabbit Polyclonal Antibody

PMCH Rabbit Polyclonal Antibody

To Order:

PMCH Polyclonal Antibody

ABP59957-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human PMCH protein at amino acid sequence of 112-161
  • Applications tips:
Description: A polyclonal antibody for detection of PMCH from Human, Mouse, Rat. This PMCH antibody is for IHC-P, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PMCH protein at amino acid sequence of 112-161

PMCH Polyclonal Antibody

ES8762-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against PMCH from Human/Mouse/Rat. This antibody is tested and validated for IHC, WB, ELISA

PMCH Polyclonal Antibody

ES8762-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against PMCH from Human/Mouse/Rat. This antibody is tested and validated for IHC, WB, ELISA

PMCH Rabbit pAb

A6692-100ul 100 ul
EUR 308

PMCH Rabbit pAb

A6692-200ul 200 ul
EUR 459

PMCH Rabbit pAb

A6692-20ul 20 ul
EUR 183

PMCH Rabbit pAb

A6692-50ul 50 ul
EUR 223

PMCH antibody

20R-1341 100 ug
EUR 377
Description: Rabbit polyclonal PMCH antibody

PMCH antibody

39106-100ul 100ul
EUR 252

PMCH Antibody

  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: PBS, pH 7.4, containing 0.02% sodium azide as Preservative and 50% Glycerol. The antibody was affinity-purified from rabbit serum by affinity-chromatography using specific immunogen.
Description: A polyclonal antibody against PMCH. Recognizes PMCH from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: IHC, ELISA;IHC-p:1:50-300, ELISA:1:10000-20000

Pmch/ Rat Pmch ELISA Kit

ELI-03769r 96 Tests
EUR 886

Anti-PMCH Antibody

A07730 100ul
EUR 397
Description: Rabbit Polyclonal Antibody for PMCH Antibody (PMCH) detection.tested for IHC in Human, Mouse, Rat.

PMCH Conjugated Antibody

C39106 100ul
EUR 397

Anti-PMCH antibody

STJ28775 100 µl
EUR 277
Description: This gene encodes a preproprotein that is proteolytically processed to generate multiple protein products. These products include melanin-concentrating hormone (MCH), neuropeptide-glutamic acid-isoleucine (NEI), and neuropeptide-glycine-glutamic acid (NGE). Melanin-concentrating hormone is a 19-amino acid neuropeptide that stimulates hunger and may additionally regulate energy homeostasis, reproductive function, and sleep. Pseudogenes of this gene have been identified on chromosome 5.

Anti-PMCH antibody

STJ98825 200 µl
EUR 197
Description: Rabbit polyclonal to PMCH.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

Pro-MCH (PMCH) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Pro-MCH (PMCH) Antibody

  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

PMCH Blocking Peptide

33R-8024 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of PMCH antibody, catalog no. 20R-1341

PMCH cloning plasmid

CSB-CL324927HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 498
  • Sequence: atggcaaaaatgaatctctcttcctatatattaatactaactttttctttgttttctcaaggtattttactttcagcatccaagtccataagaaatttagatgatgacatggtatttaatacattcaggttggggaaaggctttcagaaggaagacactgcagaaaaatcagttat
  • Show more
Description: A cloning plasmid for the PMCH gene.

pENTR223-PMCH vector

PVT11811 2 ug
EUR 304


ELA-E1144h 96 Tests
EUR 824


ELI-03771d 96 Tests
EUR 928


EF003677 96 Tests
EUR 689

Rat PMCH shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human PMCH shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse PMCH shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

PMCH Rabbit Polyclonal Antibody

Back To Top