PMCH Rabbit Polyclonal Antibody
To Order: garrett@bioworldantibodies.com
PMCH Polyclonal Antibody |
ABP59957-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human PMCH protein at amino acid sequence of 112-161
- Applications tips:
|
Description: A polyclonal antibody for detection of PMCH from Human, Mouse, Rat. This PMCH antibody is for IHC-P, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PMCH protein at amino acid sequence of 112-161 |
PMCH Polyclonal Antibody |
ES8762-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against PMCH from Human/Mouse/Rat. This antibody is tested and validated for IHC, WB, ELISA |
PMCH Polyclonal Antibody |
ES8762-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against PMCH from Human/Mouse/Rat. This antibody is tested and validated for IHC, WB, ELISA |
PMCH Rabbit pAb |
A6692-100ul |
Abclonal |
100 ul |
EUR 308 |
PMCH Rabbit pAb |
A6692-200ul |
Abclonal |
200 ul |
EUR 459 |
PMCH Rabbit pAb |
A6692-20ul |
Abclonal |
20 ul |
EUR 183 |
PMCH Rabbit pAb |
A6692-50ul |
Abclonal |
50 ul |
EUR 223 |
PMCH antibody |
20R-1341 |
Fitzgerald |
100 ug |
EUR 377 |
Description: Rabbit polyclonal PMCH antibody |
PMCH antibody |
39106-100ul |
SAB |
100ul |
EUR 252 |
PMCH Antibody |
1-CSB-PA885494 |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS, pH 7.4, containing 0.02% sodium azide as Preservative and 50% Glycerol. The antibody was affinity-purified from rabbit serum by affinity-chromatography using specific immunogen.
|
Description: A polyclonal antibody against PMCH. Recognizes PMCH from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: IHC, ELISA;IHC-p:1:50-300, ELISA:1:10000-20000 |
Anti-PMCH Antibody |
A07730 |
BosterBio |
100ul |
EUR 397 |
Description: Rabbit Polyclonal Antibody for PMCH Antibody (PMCH) detection.tested for IHC in Human, Mouse, Rat. |
PMCH Conjugated Antibody |
C39106 |
SAB |
100ul |
EUR 397 |
Anti-PMCH antibody |
STJ28775 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: This gene encodes a preproprotein that is proteolytically processed to generate multiple protein products. These products include melanin-concentrating hormone (MCH), neuropeptide-glutamic acid-isoleucine (NEI), and neuropeptide-glycine-glutamic acid (NGE). Melanin-concentrating hormone is a 19-amino acid neuropeptide that stimulates hunger and may additionally regulate energy homeostasis, reproductive function, and sleep. Pseudogenes of this gene have been identified on chromosome 5. |
Anti-PMCH antibody |
STJ98825 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Rabbit polyclonal to PMCH. |
PMCH siRNA |
20-abx904101 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
PMCH siRNA |
20-abx929031 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
PMCH siRNA |
20-abx929032 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Pro-MCH (PMCH) Antibody |
20-abx005132 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
Pro-MCH (PMCH) Antibody |
20-abx326868 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
PMCH Blocking Peptide |
33R-8024 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of PMCH antibody, catalog no. 20R-1341 |
PMCH cloning plasmid |
CSB-CL324927HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 498
- Sequence: atggcaaaaatgaatctctcttcctatatattaatactaactttttctttgttttctcaaggtattttactttcagcatccaagtccataagaaatttagatgatgacatggtatttaatacattcaggttggggaaaggctttcagaaggaagacactgcagaaaaatcagttat
- Show more
|
Description: A cloning plasmid for the PMCH gene. |
Rat PMCH shRNA Plasmid |
20-abx984585 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Human PMCH shRNA Plasmid |
20-abx953604 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Mouse PMCH shRNA Plasmid |
20-abx980068 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
PMCH Rabbit Polyclonal Antibody