RIPK2 (Phospho-Ser176) Antibody

RIPK2 (Phospho-Ser176) Antibody

To Order: garrett@bioworldantibodies.com

RIPK2 (Phospho-Ser176) Antibody
12120-100ul 100ul
EUR 252

RIPK2 (Phospho-Ser176) Antibody
12120-50ul 50ul
EUR 187

Phospho-RIPK2 (Ser176) Antibody
CSB-PA231579-
EUR 335
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic phosphopeptide and KLH conjugates. Antibodie
  • Show more
Description: A polyclonal antibody against Phospho-RIPK2 (Ser176). Recognizes Phospho-RIPK2 (Ser176) from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:3000, IHC:1:50-1:100

Phospho-RIPK2 (Ser176) Antibody
CSB-PA231579-100ul 100ul
EUR 362
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic phosphopeptide and KLH conjugates. Antibodie
  • Show more
Description: A polyclonal antibody against Phospho-RIPK2 (Ser176). Recognizes Phospho-RIPK2 (Ser176) from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:3000, IHC:1:50-1:100

RIPK2 (Phospho-Ser176) Polyclonal Antibody
ABP60180-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human RIPK2 (Phospho-Ser176) Antibody protein
  • Applications tips:
Description: A polyclonal antibody for detection of RIPK2 Phospho-Ser176) from Human, Mouse, Rat. This RIPK2 Phospho-Ser176) antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human RIPK2 (Phospho-Ser176) Antibody protein

RIPK2 (Phospho-Ser176) Polyclonal Antibody
ABP60180-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human RIPK2 (Phospho-Ser176) Antibody protein
  • Applications tips:
Description: A polyclonal antibody for detection of RIPK2 Phospho-Ser176) from Human, Mouse, Rat. This RIPK2 Phospho-Ser176) antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human RIPK2 (Phospho-Ser176) Antibody protein

RIPK2 (Phospho-Ser176) Polyclonal Antibody
ABP60180-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human RIPK2 (Phospho-Ser176) Antibody protein
  • Applications tips:
Description: A polyclonal antibody for detection of RIPK2 Phospho-Ser176) from Human, Mouse, Rat. This RIPK2 Phospho-Ser176) antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human RIPK2 (Phospho-Ser176) Antibody protein

Anti-Phospho-RIPK2 (Ser176) antibody
STJ99600 200 µl
EUR 197
Description: Rabbit polyclonal to Phospho-RIPK2 (Ser176).

RIPK2 antibody (Ser176)
70R-32731 100 ug
EUR 327
Description: Rabbit polyclonal RIPK2 antibody (Ser176)

Phospho-RIPK2(Ser176) Blocking Peptide
AF0049-BP 1mg
EUR 195

RIPK2 (Phospho-Ser176) Colorimetric Cell-Based ELISA Kit
EKC2582 100ul
EUR 572

Phospho-RIPK2 (Ser176) Colorimetric Cell-Based ELISA Kit (OKAG02134)
OKAG02134 2 x 96 Wells
EUR 740
Description: Description of target: ;Species reactivity: Human: S176, Mouse: S176;Application: ELISA;Assay info: Assay Type: Cell-Based
Subtype: Phospho
Detection Method: Colorimetric 450 nm;Sensitivity:

Receptor Interacting Serine Threonine Kinase 2 Phospho-Ser176 (RIPK2 pS176) Antibody
20-abx325915
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Receptor Interacting Serine Threonine Kinase 2 Phospho-Ser176 (RIPK2 pS176) Antibody
abx333065-100ul 100 ul
EUR 467
  • Shipped within 5-10 working days.

Phospho-YB1 (Ser176) Antibody
AF7332 200ul
EUR 376
Description: Phospho-YB1 (Ser176) Antibody detects endogenous levels of YB1 only when phosphorylated at Ser176.

Phospho- RIP2 (Ser176) Antibody
ABF3730 100 ug
EUR 438

YB1 (Phospho-Ser176) Antibody
13181-100ul 100ul
EUR 252

YB1 (Phospho-Ser176) Antibody
13181-50ul 50ul
EUR 187

YB1 (Phospho-Ser176) Conjugated Antibody
C13181 100ul
EUR 397

RIP2 (phospho Ser176) Polyclonal Antibody
ES7873-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against RIP2 (phospho Ser176) from Human/Mouse. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA

RIP2 (phospho Ser176) Polyclonal Antibody
ES7873-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against RIP2 (phospho Ser176) from Human/Mouse. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA

RIP2 (phospho Ser176) Polyclonal Antibody
ABP56874-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from human RIP2 around the phosphorylation site of S176
  • Applications tips:
Description: A polyclonal antibody for detection of RIP2 phospho Ser176) from Human, Mouse. This RIP2 phospho Ser176) antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human RIP2 around the phosphorylation site of S176

RIP2 (phospho Ser176) Polyclonal Antibody
ABP56874-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from human RIP2 around the phosphorylation site of S176
  • Applications tips:
Description: A polyclonal antibody for detection of RIP2 phospho Ser176) from Human, Mouse. This RIP2 phospho Ser176) antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human RIP2 around the phosphorylation site of S176

RIP2 (phospho Ser176) Polyclonal Antibody
ABP56874-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from human RIP2 around the phosphorylation site of S176
  • Applications tips:
Description: A polyclonal antibody for detection of RIP2 phospho Ser176) from Human, Mouse. This RIP2 phospho Ser176) antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human RIP2 around the phosphorylation site of S176

Phospho-RIPK2 (Ser531) Antibody
AF7118 200ul
EUR 376
Description: Phospho-RIPK2 (Ser531) Antibody detects endogenous levels of RIPK2 only when phosphorylated at Ser531.

RIPK2 (Phospho-Ser531) Antibody
12981-100ul 100ul
EUR 252

RIPK2 (Phospho-Ser531) Antibody
12981-50ul 50ul
EUR 187

RIPK2 (Phospho-Tyr381) Antibody
12982-100ul 100ul
EUR 252

RIPK2 (Phospho-Tyr381) Antibody
12982-50ul 50ul
EUR 187

Phospho-RIPK2 (S176) Antibody
1-CSB-PA070142
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against Phospho-RIPK2 (S176). Recognizes Phospho-RIPK2 (S176) from Human, Mouse. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/40000

IKK?/? (phospho Ser176/177) Polyclonal Antibody
ES4646-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against IKK?/? (phospho Ser176/177) from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA

IKK?/? (phospho Ser176/177) Polyclonal Antibody
ES4646-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against IKK?/? (phospho Ser176/177) from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA

IKK alpha/beta antibody (Phospho-Ser176)
70R-11103 50 ug
EUR 327
Description: Rabbit polyclonal IKK alpha/beta antibody for detection of the Phospho-Ser176 form of the IKK alpha/beta peptide.

Phospho-CHUK/IKBKB (Ser176/177) Antibody
CSB-PA983649-
EUR 335
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic phosphopeptide and KLH conjugates. Antibodie
  • Show more
Description: A polyclonal antibody against Phospho-CHUK/IKBKB (Ser176/177). Recognizes Phospho-CHUK/IKBKB (Ser176/177) from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:1000

Phospho-CHUK/IKBKB (Ser176/177) Antibody
CSB-PA983649-100ul 100ul
EUR 362
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic phosphopeptide and KLH conjugates. Antibodie
  • Show more
Description: A polyclonal antibody against Phospho-CHUK/IKBKB (Ser176/177). Recognizes Phospho-CHUK/IKBKB (Ser176/177) from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:1000

Phospho-YB1 (Ser176) Blocking Peptide
AF7332-BP 1mg
EUR 195

RIPK2 (Phospho-Tyr381) Conjugated Antibody
C12982 100ul
EUR 397

IKKAlpha/Beta (phospho Ser176/177) Polyclonal Antibody
ABP53647-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from human IKK?/? around the phosphorylation site of S176/177
  • Applications tips:
Description: A polyclonal antibody for detection of IKKAlpha/Beta phospho Ser176/177) from Human, Mouse, Rat. This IKKAlpha/Beta phospho Ser176/177) antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human IKK?/? around the phosphorylation site of S176/177

IKKAlpha/Beta (phospho Ser176/177) Polyclonal Antibody
ABP53647-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from human IKK?/? around the phosphorylation site of S176/177
  • Applications tips:
Description: A polyclonal antibody for detection of IKKAlpha/Beta phospho Ser176/177) from Human, Mouse, Rat. This IKKAlpha/Beta phospho Ser176/177) antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human IKK?/? around the phosphorylation site of S176/177

IKKAlpha/Beta (phospho Ser176/177) Polyclonal Antibody
ABP53647-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from human IKK?/? around the phosphorylation site of S176/177
  • Applications tips:
Description: A polyclonal antibody for detection of IKKAlpha/Beta phospho Ser176/177) from Human, Mouse, Rat. This IKKAlpha/Beta phospho Ser176/177) antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human IKK?/? around the phosphorylation site of S176/177

IKK- alpha/ beta (Phospho-Ser176/177) Antibody
11931-100ul 100ul
EUR 252

IKK- alpha/ beta (Phospho-Ser176/177) Antibody
11931-50ul 50ul
EUR 187

anti-IKK α/β (Phospho-Ser176)
LF-PA20648 100 ul
EUR 354
Description: Rabbit polyclonal to IKK α/β (Phospho-Ser176)

RIPK2 (Phospho-Ser531) Polyclonal Conjugated Antibody
C12981 100ul
EUR 397

Phospho-IKK alpha (Ser176) /IKK beta (Ser177) Antibody
AF3014 200ul
EUR 304
Description: Phospho-IKK- alpha (Ser176) /IKK- beta (Ser177) Antibody detects endogenous levels of IKK- alpha /IKK- beta only when phosphorylated at Serine 177.

Phospho- IKK- alpha (Ser176) /IKK- beta (Ser177) Antibody
ABF3014 100 ug
EUR 438

Phospho-RIPK2 (Ser531) Blocking Peptide
AF7118-BP 1mg
EUR 195

RIPK2 Antibody
AF7618 200ul
EUR 376
Description: RIPK2 Antibody detects endogenous levels of RIPK2.

RIPK2 antibody
70R-32732 100 ug
EUR 327
Description: Rabbit polyclonal RIPK2 antibody

RIPK2 Antibody
ABD2641 100 ug
EUR 438

RIPK2 Antibody
ABD6967 100 ug
EUR 438

RIPK2 Antibody
32675-100ul 100ul
EUR 252

RIPK2 antibody
70R-19904 50 ul
EUR 435
Description: Rabbit polyclonal RIPK2 antibody

RIPK2 antibody
70R-10459 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal RIPK2 antibody

RIPK2 Antibody
DF6967 200ul
EUR 304
Description: RIPK2 Antibody detects endogenous levels of total RIPK2.

RIPK2 Antibody
DF2641 200ul
EUR 304
Description: RIPK2 antibody detects endogenous levels of total RIPK2.

RIPK2 Antibody
1-CSB-PA070143
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against RIPK2. Recognizes RIPK2 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/40000

RIPK2 Antibody
1-CSB-PA019736ESR1HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against RIPK2. Recognizes RIPK2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

RIPK2 Antibody
1-CSB-PA019736GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against RIPK2. Recognizes RIPK2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

RIPK2 Antibody
1-CSB-PA019736LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RIPK2. Recognizes RIPK2 from Human, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:500-1:5000, IHC:1:100-1:500, IF:1:50-1:500

IKK- alpha/ beta (Phospho-Ser176/177) Polyclonal Conjugated Antibody
C11931 100ul
EUR 397

RIPK2 Conjugated Antibody
C32675 100ul
EUR 397

anti- RIPK2 antibody
FNab07314 100µg
EUR 548.75
  • Immunogen: receptor-interacting serine-threonine kinase 2
  • Uniprot ID: O43353
  • Gene ID: 8767
  • Research Area: Immunology, Signal Transduction, Metabolism
Description: Antibody raised against RIPK2

RIPK2 (pS176) Antibody
abx011477-100ug 100 ug
EUR 439
  • Shipped within 5-10 working days.

RIPK2 (pS176) Antibody
abx011478-100ug 100 ug
EUR 439
  • Shipped within 5-10 working days.

RIPK2 Polyclonal Antibody
A54388 100 µg
EUR 570.55
Description: kits suitable for this type of research

Anti-RIPK2 antibody
PAab07314 100 ug
EUR 386

Anti-RIPK2 Antibody
STJ502801 100 µg
EUR 476

Anti-RIPK2 antibody
STJ25358 100 µl
EUR 277
Description: This gene encodes a member of the receptor-interacting protein (RIP) family of serine/threonine protein kinases. The encoded protein contains a C-terminal caspase activation and recruitment domain (CARD), and is a component of signaling complexes in both the innate and adaptive immune pathways. It is a potent activator of NF-kappaB and inducer of apoptosis in response to various stimuli.

Anti-RIPK2 antibody
STJ115343 100 µl
EUR 277
Description: This gene encodes a member of the receptor-interacting protein (RIP) family of serine/threonine protein kinases. The encoded protein contains a C-terminal caspase activation and recruitment domain (CARD), and is a component of signaling complexes in both the innate and adaptive immune pathways. It is a potent activator of NF-kappaB and inducer of apoptosis in response to various stimuli.

IKK a/b antibody (Ser176)
70R-37438 100 ug
EUR 349
Description: Rabbit Polyclonal IKK a/b antibody (Ser176)

IKK alpha/beta antibody (Ser176)
70R-31308 100 ug
EUR 327
Description: Rabbit polyclonal IKK alpha/beta antibody (Ser176)

Phospho-IKK alpha (Ser176) /IKK beta (Ser177) Blocking Peptide
AF3014-BP 1mg
EUR 195

RIPK2 siRNA
20-abx931564
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

RIPK2 siRNA
20-abx931565
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

RIPK2, Active
7747-5
EUR 370

RIPK2 protein
30R-2861 5 ug
EUR 503
Description: Purified recombinant Human RIPK2 protein

RIPK2 Antibody, HRP conjugated
1-CSB-PA019736LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RIPK2. Recognizes RIPK2 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

RIPK2 Antibody, FITC conjugated
1-CSB-PA019736LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RIPK2. Recognizes RIPK2 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

RIPK2 Antibody, Biotin conjugated
1-CSB-PA019736LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RIPK2. Recognizes RIPK2 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Anti-RIP2/RIPK2 Antibody
PA1861 100ug/vial
EUR 294

Anti-RIPK2 Antibody (Biotin)
STJ502802 100 µg
EUR 586

Anti-RIPK2 Antibody (FITC)
STJ502803 100 µg
EUR 586

IKK-alpha (Phospho-Ser176) /IKK-beta (Phospho-Ser177) Colorimetric Cell-Based ELISA Kit
EKC2043 100ul
EUR 572

RIPK2 Blocking Peptide
AF7618-BP 1mg
EUR 195

RIPK2 cloning plasmid
CSB-CL019736HU-10ug 10ug
EUR 376
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1623
  • Sequence: atgaacggggaggccatctgcagcgccctgcccaccattccctaccacaaactcgccgacctgcgctacctgagccgcggcgcctctggcactgtgtcgtccgcccgccacgcagactggcgcgtccaggtggccgtgaagcacctgcacatccacactccgctgctcgacagtg
  • Show more
Description: A cloning plasmid for the RIPK2 gene.

RIPK2 Rabbit pAb
A13381-100ul 100 ul
EUR 308

RIPK2 Rabbit pAb
A13381-200ul 200 ul
EUR 459

RIPK2 Rabbit pAb
A13381-20ul 20 ul
EUR 183

RIPK2 Rabbit pAb
A13381-50ul 50 ul
EUR 223

RIPK2 Rabbit pAb
A2498-100ul 100 ul
EUR 308

RIPK2 Rabbit pAb
A2498-200ul 200 ul
EUR 459

RIPK2 Rabbit pAb
A2498-20ul 20 ul
EUR 183

RIPK2 Rabbit pAb
A2498-50ul 50 ul
EUR 223

RIPK2 Blocking Peptide
33R-5381 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of RIPK2 antibody, catalog no. 70R-10459

RIPK2 Blocking Peptide
DF6967-BP 1mg
EUR 195

RIPK2 Blocking Peptide
DF2641-BP 1mg
EUR 195

Polyclonal RIPK2 Antibody (C-term)
AMR09745G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human RIPK2 (C-term). This antibody is tested and proven to work in the following applications:

Polyclonal RIPK2 Antibody (N-term)
AMR09748G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human RIPK2 (N-term). This antibody is tested and proven to work in the following applications:

RIPK2 Polyclonal Antibody, Biotin Conjugated
A54385 100 µg
EUR 570.55
Description: The best epigenetics products

RIPK2 Polyclonal Antibody, FITC Conjugated
A54386 100 µg
EUR 570.55
Description: kits suitable for this type of research

RIPK2 Polyclonal Antibody, HRP Conjugated
A54387 100 µg
EUR 570.55
Description: fast delivery possible

RIPK2 Cell ELISA Kit
abx595529-96tests 96 tests
EUR 637
  • Shipped within 1-2 weeks.

Mouse RIPK2 shRNA Plasmid
20-abx980440
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human RIPK2 ELISA Kit
EHR0362 96Tests
EUR 521

Human RIPK2 ELISA Kit
ELA-E1786h 96 Tests
EUR 824

Goat RIPK2 ELISA Kit
EGTR0362 96Tests
EUR 521

Bovine RIPK2 ELISA Kit
EBR0362 96Tests
EUR 521

Chicken RIPK2 ELISA Kit
ECKR0362 96Tests
EUR 521

Anserini RIPK2 ELISA Kit
EAR0362 96Tests
EUR 521

Canine RIPK2 ELISA Kit
ECR0362 96Tests
EUR 521

Bovine RIPK2 ELISA KIT
ELI-05786b 96 Tests
EUR 928

Human RIPK2 ELISA KIT
ELI-05787h 96 Tests
EUR 824

Mouse Ripk2 ELISA KIT
ELI-05788m 96 Tests
EUR 865

RIPK2 ELISA KIT|Human
EF007144 96 Tests
EUR 689

Porcine RIPK2 ELISA Kit
EPR0362 96Tests
EUR 521

Rat RIPK2 ELISA Kit
ERR0362 96Tests
EUR 521

Sheep RIPK2 ELISA Kit
ESR0362 96Tests
EUR 521

Rabbit RIPK2 ELISA Kit
ERTR0362 96Tests
EUR 521

Monkey RIPK2 ELISA Kit
EMKR0362 96Tests
EUR 521

Mouse RIPK2 ELISA Kit
EMR0362 96Tests
EUR 521

Human RIPK2 shRNA Plasmid
20-abx955775
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Phospho-IKK- Alpha (Ser176) /IKK- Beta (Ser177) Colorimetric Cell-Based ELISA Kit (OKAG01568)
OKAG01568 2 x 96 Wells
EUR 740
Description: Description of target: ;Species reactivity: Human: S176/S177, Mouse: S176/S177, Rat: S176/S177;Application: ELISA;Assay info: Assay Type: Cell-Based
Subtype: Phospho
Detection Method: Colorimetric 450 nm;Sensitivity:

Monoclonal RIPK2 Antibody (monoclonal) (M02), Clone: 6F7
AMR09746G 0.1mg
EUR 484
Description: A Monoclonal antibody against Human RIPK2 (monoclonal) (M02). The antibodies are raised in Mouse and are from clone 6F7. This antibody is applicable in WB and IHC, E

Monoclonal RIPK2 Antibody (monoclonal) (M05), Clone: 7F5
AMR09747G 0.1mg
EUR 484
Description: A Monoclonal antibody against Human RIPK2 (monoclonal) (M05). The antibodies are raised in Mouse and are from clone 7F5. This antibody is applicable in WB and IHC, E

Guinea Pig RIPK2 ELISA Kit
EGR0362 96Tests
EUR 521

RIPK2 ORF Vector (Human) (pORF)
ORF008828 1.0 ug DNA
EUR 95

h RIPK2 inducible lentiviral particles
LVP222 1x107 IFU/ml x 200ul
EUR 451
Description: Pre-made tet-inducible lentiviral particles expressing a human gene with a Blasticidin-RFP fusion marker (Dual selection). The expressed human gene, RIPK2, is fully sequence verified and matched to NCBI accession ID: NM_003821

Ripk2 ORF Vector (Mouse) (pORF)
ORF056095 1.0 ug DNA
EUR 506

Ripk2 ORF Vector (Rat) (pORF)
ORF075393 1.0 ug DNA
EUR 506

RIPK2 ELISA Kit (Mouse) (OKEH05329)
OKEH05329 96 Wells
EUR 662
Description: Description of target: Serine/threonine/tyrosine kinase that plays an essential role in modulation of innate and adaptive immune responses. Upon stimulation by bacterial peptidoglycans, NOD1 and NOD2 are activated, oligomerize and recruit RIPK2 through CARD-CARD domains. Once recruited, autophosphorylates and undergoes 'Lys-63'-linked polyubiquitination by E3 ubiquitin ligases XIAP, BIRC2 and BIRC3. The polyubiquitinated protein mediates the recruitment of MAP3K7/TAK1 to IKBKG/NEMO and induces 'Lys-63'-linked polyubiquitination of IKBKG/NEMO and subsequent activation of IKBKB/IKKB. In turn, NF-kappa-B is release from NF-kappa-B inhibitors and translocates into the nucleus where it activates the transcription of hundreds of genes involved in immune response, growth control, or protection against apoptosis. Plays also a role during engagement of the T-cell receptor (TCR) in promoting BCL10 phosphorylation and subsequent NF-kappa-B activation.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.082 ng/mL

RIPK2 ELISA Kit (Human) (OKEH05330)
OKEH05330 96 Wells
EUR 662
Description: Description of target: Serine/threonine/tyrosine kinase that plays an essential role in modulation of innate and adaptive immune responses. Upon stimulation by bacterial peptidoglycans, NOD1 and NOD2 are activated, oligomerize and recruit RIPK2 through CARD-CARD domains. Contributes to the tyrosine phosphorylation of the guanine exchange factor ARHGEF2 through Src tyrosine kinase leading to NF-kappaB activation by NOD2. Once recruited, RIPK2 autophosphorylates and undergoes 'Lys-63'-linked polyubiquitination by E3 ubiquitin ligases XIAP, BIRC2 and BIRC3. The polyubiquitinated protein mediates the recruitment of MAP3K7/TAK1 to IKBKG/NEMO and induces 'Lys-63'-linked polyubiquitination of IKBKG/NEMO and subsequent activation of IKBKB/IKKB. In turn, NF-kappa-B is released from NF-kappa-B inhibitors and translocates into the nucleus where it activates the transcription of hundreds of genes involved in immune response, growth control, or protection against apoptosis. Plays also a role during engagement of the T-cell receptor (TCR) in promoting BCL10 phosphorylation and subsequent NF-kappa-B activation.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 40 pg/mL

Receptor-Interacting Serine-Threonine Kinase 2 (RIPK2) Antibody
20-abx115090
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Receptor Interacting Serine Threonine Kinase 2 (RIPK2) Antibody
20-abx130789
  • EUR 439.00
  • EUR 133.00
  • EUR 1233.00
  • EUR 592.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Receptor Interacting Serine Threonine Kinase 2 (RIPK2) Antibody
20-abx130790
  • EUR 425.00
  • EUR 133.00
  • EUR 1177.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Receptor Interacting Serine Threonine Kinase 2 (RIPK2) Antibody
20-abx130791
  • EUR 411.00
  • EUR 133.00
  • EUR 1149.00
  • EUR 565.00
  • EUR 314.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Receptor Interacting Serine Threonine Kinase 2 (RIPK2) Antibody
20-abx110168
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Receptor Interacting Serine Threonine Kinase 2 (RIPK2) Antibody
20-abx001942
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Receptor Interacting Serine Threonine Kinase 2 (RIPK2) Antibody
20-abx142197
  • EUR 370.00
  • EUR 606.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.

Receptor Interacting Serine Threonine Kinase 2 (RIPK2) Antibody
abx037474-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Receptor Interacting Serine Threonine Kinase 2 (RIPK2) Antibody
abx038405-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Receptor Interacting Serine Threonine Kinase 2 (RIPK2) Antibody
abx033703-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Receptor Interacting Serine Threonine Kinase 2 (RIPK2) Antibody
abx033703-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Receptor Interacting Serine Threonine Kinase 2 (RIPK2) Antibody
abx027587-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Receptor Interacting Serine Threonine Kinase 2 (RIPK2) Antibody
abx027587-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Receptor Interacting Serine Threonine Kinase 2 (RIPK2) Antibody
20-abx325914
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Receptor Interacting Serine Threonine Kinase 2 (RIPK2) Antibody
20-abx320653
  • EUR 300.00
  • EUR 244.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Receptor Interacting Serine Threonine Kinase 2 (RIPK2) Antibody
abx237314-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

RIPK2 Colorimetric Cell-Based ELISA Kit
EKC1506 100ul
EUR 572

RIPK2 (Phospho-Ser176) Antibody

Back To Top