RIPK2 (Phospho-Ser176) Antibody
To Order: garrett@bioworldantibodies.com
Phospho-RIPK2(Ser176) Antibody |
AF0049 |
Affbiotech |
200ul |
EUR 304 |
Description: Phospho-RIPK2(Ser176) Antibody detects endogenous levels of RIPK2 only when phosphorylated at Sersine 176. |
Phospho-RIPK2 (Ser176) Antibody |
A1724-100 |
Biovision |
|
EUR 479 |
RIPK2 (Phospho-Ser176) Polyclonal Antibody |
ABP60180-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Synthesized peptide derived from part region of human RIPK2 (Phospho-Ser176) Antibody protein
- Applications tips:
|
Description: A polyclonal antibody for detection of RIPK2 Phospho-Ser176) from Human, Mouse, Rat. This RIPK2 Phospho-Ser176) antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human RIPK2 (Phospho-Ser176) Antibody protein |
RIPK2 (Phospho-Ser176) Polyclonal Antibody |
ABP60180-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from part region of human RIPK2 (Phospho-Ser176) Antibody protein
- Applications tips:
|
Description: A polyclonal antibody for detection of RIPK2 Phospho-Ser176) from Human, Mouse, Rat. This RIPK2 Phospho-Ser176) antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human RIPK2 (Phospho-Ser176) Antibody protein |
RIPK2 (Phospho-Ser176) Polyclonal Antibody |
ABP60180-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human RIPK2 (Phospho-Ser176) Antibody protein
- Applications tips:
|
Description: A polyclonal antibody for detection of RIPK2 Phospho-Ser176) from Human, Mouse, Rat. This RIPK2 Phospho-Ser176) antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human RIPK2 (Phospho-Ser176) Antibody protein |
Anti-Phospho-RIPK2 (Ser176) antibody |
STJ99600 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Rabbit polyclonal to Phospho-RIPK2 (Ser176). |
RIPK2 antibody (Ser176) |
70R-32731 |
Fitzgerald |
100 ug |
EUR 327 |
Description: Rabbit polyclonal RIPK2 antibody (Ser176) |
Phospho-RIPK2(Ser176) Blocking Peptide |
AF0049-BP |
Affbiotech |
1mg |
EUR 195 |
RIPK2 (Phospho-Ser176) Colorimetric Cell-Based ELISA Kit |
EKC2582 |
BosterBio |
100ul |
EUR 572 |
Phospho-RIPK2 (Ser176) Colorimetric Cell-Based ELISA Kit (OKAG02134) |
OKAG02134 |
Aviva Systems Biology |
2 x 96 Wells |
EUR 740 |
Description: Description of target: ;Species reactivity: Human: S176, Mouse: S176;Application: ELISA;Assay info: Assay Type: Cell-Based Subtype: Phospho Detection Method: Colorimetric 450 nm;Sensitivity: |
Receptor Interacting Serine Threonine Kinase 2 Phospho-Ser176 (RIPK2 pS176) Antibody |
20-abx325915 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Receptor Interacting Serine Threonine Kinase 2 Phospho-Ser176 (RIPK2 pS176) Antibody |
abx333065-100ul |
Abbexa |
100 ul |
EUR 467 |
- Shipped within 5-10 working days.
|
YB1 (Phospho-Ser176) Antibody |
13181-100ul |
SAB |
100ul |
EUR 252 |
YB1 (Phospho-Ser176) Antibody |
13181-50ul |
SAB |
50ul |
EUR 187 |
Phospho-YB1 (Ser176) Antibody |
AF7332 |
Affbiotech |
200ul |
EUR 376 |
Description: Phospho-YB1 (Ser176) Antibody detects endogenous levels of YB1 only when phosphorylated at Ser176. |
YB1 (Phospho-Ser176) Conjugated Antibody |
C13181 |
SAB |
100ul |
EUR 397 |
RIP2 (phospho Ser176) Polyclonal Antibody |
ABP56874-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Synthesized peptide derived from human RIP2 around the phosphorylation site of S176
- Applications tips:
|
Description: A polyclonal antibody for detection of RIP2 phospho Ser176) from Human, Mouse. This RIP2 phospho Ser176) antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human RIP2 around the phosphorylation site of S176 |
RIP2 (phospho Ser176) Polyclonal Antibody |
ABP56874-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from human RIP2 around the phosphorylation site of S176
- Applications tips:
|
Description: A polyclonal antibody for detection of RIP2 phospho Ser176) from Human, Mouse. This RIP2 phospho Ser176) antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human RIP2 around the phosphorylation site of S176 |
RIP2 (phospho Ser176) Polyclonal Antibody |
ABP56874-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from human RIP2 around the phosphorylation site of S176
- Applications tips:
|
Description: A polyclonal antibody for detection of RIP2 phospho Ser176) from Human, Mouse. This RIP2 phospho Ser176) antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human RIP2 around the phosphorylation site of S176 |
RIP2 (phospho Ser176) Polyclonal Antibody |
ES7873-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against RIP2 (phospho Ser176) from Human/Mouse. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA |
RIP2 (phospho Ser176) Polyclonal Antibody |
ES7873-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against RIP2 (phospho Ser176) from Human/Mouse. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA |
RIPK2 (Phospho-Ser531) Antibody |
12981-100ul |
SAB |
100ul |
EUR 252 |
RIPK2 (Phospho-Ser531) Antibody |
12981-50ul |
SAB |
50ul |
EUR 187 |
RIPK2 (Phospho-Tyr381) Antibody |
12982-100ul |
SAB |
100ul |
EUR 252 |
RIPK2 (Phospho-Tyr381) Antibody |
12982-50ul |
SAB |
50ul |
EUR 187 |
Phospho-RIPK2 (S176) Antibody |
1-CSB-PA070142 |
Cusabio |
|
|
- Form: Liquid
- Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
|
Description: A polyclonal antibody against Phospho-RIPK2 (S176). Recognizes Phospho-RIPK2 (S176) from Human, Mouse. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/40000 |
Phospho-RIPK2 (Ser531) Antibody |
AF7118 |
Affbiotech |
200ul |
EUR 376 |
Description: Phospho-RIPK2 (Ser531) Antibody detects endogenous levels of RIPK2 only when phosphorylated at Ser531. |
IKK alpha/beta antibody (Phospho-Ser176) |
70R-11103 |
Fitzgerald |
50 ug |
EUR 327 |
Description: Rabbit polyclonal IKK alpha/beta antibody for detection of the Phospho-Ser176 form of the IKK alpha/beta peptide. |
Phospho-CHUK/IKBKB (Ser176/177) Antibody |
CSB-PA983649- |
Cusabio |
|
EUR 335 |
- Form: liquid
- Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic phosphopeptide and KLH conjugates. Antibodie
- Show more
|
Description: A polyclonal antibody against Phospho-CHUK/IKBKB (Ser176/177). Recognizes Phospho-CHUK/IKBKB (Ser176/177) from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:1000 |
Phospho-CHUK/IKBKB (Ser176/177) Antibody |
CSB-PA983649-100ul |
Cusabio |
100ul |
EUR 362 |
- Form: liquid
- Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic phosphopeptide and KLH conjugates. Antibodie
- Show more
|
Description: A polyclonal antibody against Phospho-CHUK/IKBKB (Ser176/177). Recognizes Phospho-CHUK/IKBKB (Ser176/177) from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:1000 |
IKK?/? (phospho Ser176/177) Polyclonal Antibody |
ES4646-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against IKK?/? (phospho Ser176/177) from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA |
IKK?/? (phospho Ser176/177) Polyclonal Antibody |
ES4646-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against IKK?/? (phospho Ser176/177) from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA |
Phospho-YB1 (Ser176) Blocking Peptide |
AF7332-BP |
Affbiotech |
1mg |
EUR 195 |
RIPK2 (Phospho-Tyr381) Conjugated Antibody |
C12982 |
SAB |
100ul |
EUR 397 |
IKK- alpha/ beta (Phospho-Ser176/177) Antibody |
11931-100ul |
SAB |
100ul |
EUR 252 |
IKK- alpha/ beta (Phospho-Ser176/177) Antibody |
11931-50ul |
SAB |
50ul |
EUR 187 |
IKKAlpha/Beta (phospho Ser176/177) Polyclonal Antibody |
ABP53647-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Synthesized peptide derived from human IKK?/? around the phosphorylation site of S176/177
- Applications tips:
|
Description: A polyclonal antibody for detection of IKKAlpha/Beta phospho Ser176/177) from Human, Mouse, Rat. This IKKAlpha/Beta phospho Ser176/177) antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human IKK?/? around the phosphorylation site of S176/177 |
IKKAlpha/Beta (phospho Ser176/177) Polyclonal Antibody |
ABP53647-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from human IKK?/? around the phosphorylation site of S176/177
- Applications tips:
|
Description: A polyclonal antibody for detection of IKKAlpha/Beta phospho Ser176/177) from Human, Mouse, Rat. This IKKAlpha/Beta phospho Ser176/177) antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human IKK?/? around the phosphorylation site of S176/177 |
IKKAlpha/Beta (phospho Ser176/177) Polyclonal Antibody |
ABP53647-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from human IKK?/? around the phosphorylation site of S176/177
- Applications tips:
|
Description: A polyclonal antibody for detection of IKKAlpha/Beta phospho Ser176/177) from Human, Mouse, Rat. This IKKAlpha/Beta phospho Ser176/177) antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human IKK?/? around the phosphorylation site of S176/177 |
anti-IKK α/β (Phospho-Ser176) |
LF-PA20648 |
Abfrontier |
100 ul |
EUR 354 |
Description: Rabbit polyclonal to IKK α/β (Phospho-Ser176) |
RIPK2 (Phospho-Ser531) Polyclonal Conjugated Antibody |
C12981 |
SAB |
100ul |
EUR 397 |
Phospho-IKK alpha (Ser176) /IKK beta (Ser177) Antibody |
AF3014 |
Affbiotech |
200ul |
EUR 304 |
Description: Phospho-IKK- alpha (Ser176) /IKK- beta (Ser177) Antibody detects endogenous levels of IKK- alpha /IKK- beta only when phosphorylated at Serine 177. |
Phospho- IKK- alpha (Ser176) /IKK- beta (Ser177) Antibody |
ABF3014 |
Lifescience Market |
100 ug |
EUR 438 |
Phospho-RIPK2 (Ser531) Blocking Peptide |
AF7118-BP |
Affbiotech |
1mg |
EUR 195 |
RIPK2 antibody |
70R-10459 |
Fitzgerald |
50 ug |
EUR 467 |
Description: Affinity purified rabbit polyclonal RIPK2 antibody |
RIPK2 antibody |
70R-19904 |
Fitzgerald |
50 ul |
EUR 435 |
Description: Rabbit polyclonal RIPK2 antibody |
RIPK2 Antibody |
32675-100ul |
SAB |
100ul |
EUR 252 |
RIPK2 Antibody |
1-CSB-PA070143 |
Cusabio |
|
|
- Form: Liquid
- Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
|
Description: A polyclonal antibody against RIPK2. Recognizes RIPK2 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/40000 |
RIPK2 Antibody |
DF2641 |
Affbiotech |
200ul |
EUR 304 |
Description: RIPK2 antibody detects endogenous levels of total RIPK2. |
RIPK2 Antibody |
DF6967 |
Affbiotech |
200ul |
EUR 304 |
Description: RIPK2 Antibody detects endogenous levels of total RIPK2. |
RIPK2 antibody |
70R-32732 |
Fitzgerald |
100 ug |
EUR 327 |
Description: Rabbit polyclonal RIPK2 antibody |
RIPK2 Antibody |
1-CSB-PA019736ESR1HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
|
Description: A polyclonal antibody against RIPK2. Recognizes RIPK2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200 |
RIPK2 Antibody |
1-CSB-PA019736GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
|
Description: A polyclonal antibody against RIPK2. Recognizes RIPK2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB |
RIPK2 Antibody |
1-CSB-PA019736LA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against RIPK2. Recognizes RIPK2 from Human, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:500-1:5000, IHC:1:100-1:500, IF:1:50-1:500 |
RIPK2 Antibody |
AF7618 |
Affbiotech |
200ul |
EUR 376 |
Description: RIPK2 Antibody detects endogenous levels of RIPK2. |
IKK- alpha/ beta (Phospho-Ser176/177) Polyclonal Conjugated Antibody |
C11931 |
SAB |
100ul |
EUR 397 |
RIPK2 (pS176) Antibody |
abx011477-100ug |
Abbexa |
100 ug |
EUR 439 |
- Shipped within 5-10 working days.
|
RIPK2 (pS176) Antibody |
abx011478-100ug |
Abbexa |
100 ug |
EUR 439 |
- Shipped within 5-10 working days.
|
RIPK2 Conjugated Antibody |
C32675 |
SAB |
100ul |
EUR 397 |
RIPK2 Polyclonal Antibody |
A54388 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: kits suitable for this type of research |
anti- RIPK2 antibody |
FNab07314 |
FN Test |
100µg |
EUR 548.75 |
- Immunogen: receptor-interacting serine-threonine kinase 2
- Uniprot ID: O43353
- Gene ID: 8767
- Research Area: Immunology, Signal Transduction, Metabolism
|
Description: Antibody raised against RIPK2 |
Anti-RIPK2 antibody |
STJ25358 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: This gene encodes a member of the receptor-interacting protein (RIP) family of serine/threonine protein kinases. The encoded protein contains a C-terminal caspase activation and recruitment domain (CARD), and is a component of signaling complexes in both the innate and adaptive immune pathways. It is a potent activator of NF-kappaB and inducer of apoptosis in response to various stimuli. |
Anti-RIPK2 antibody |
STJ115343 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: This gene encodes a member of the receptor-interacting protein (RIP) family of serine/threonine protein kinases. The encoded protein contains a C-terminal caspase activation and recruitment domain (CARD), and is a component of signaling complexes in both the innate and adaptive immune pathways. It is a potent activator of NF-kappaB and inducer of apoptosis in response to various stimuli. |
IKK alpha/beta antibody (Ser176) |
70R-31308 |
Fitzgerald |
100 ug |
EUR 327 |
Description: Rabbit polyclonal IKK alpha/beta antibody (Ser176) |
IKK a/b antibody (Ser176) |
70R-37438 |
Fitzgerald |
100 ug |
EUR 349 |
Description: Rabbit Polyclonal IKK a/b antibody (Ser176) |
Phospho-IKK alpha (Ser176) /IKK beta (Ser177) Blocking Peptide |
AF3014-BP |
Affbiotech |
1mg |
EUR 195 |
RIPK2 protein |
30R-2861 |
Fitzgerald |
5 ug |
EUR 503 |
Description: Purified recombinant Human RIPK2 protein |
RIPK2 siRNA |
20-abx931564 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
RIPK2 siRNA |
20-abx931565 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
RIPK2 Antibody, HRP conjugated |
1-CSB-PA019736LB01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against RIPK2. Recognizes RIPK2 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
RIPK2 Antibody, FITC conjugated |
1-CSB-PA019736LC01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against RIPK2. Recognizes RIPK2 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
RIPK2 Antibody, Biotin conjugated |
1-CSB-PA019736LD01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against RIPK2. Recognizes RIPK2 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
Anti-RIP2/RIPK2 Antibody |
PA1861 |
BosterBio |
100ug/vial |
EUR 294 |
IKK-alpha (Phospho-Ser176) /IKK-beta (Phospho-Ser177) Colorimetric Cell-Based ELISA Kit |
EKC2043 |
BosterBio |
100ul |
EUR 572 |
RIPK2 Rabbit pAb |
A13381-100ul |
Abclonal |
100 ul |
EUR 308 |
RIPK2 Rabbit pAb |
A13381-200ul |
Abclonal |
200 ul |
EUR 459 |
RIPK2 Rabbit pAb |
A13381-20ul |
Abclonal |
20 ul |
EUR 183 |
RIPK2 Rabbit pAb |
A13381-50ul |
Abclonal |
50 ul |
EUR 223 |
RIPK2 Blocking Peptide |
33R-5381 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of RIPK2 antibody, catalog no. 70R-10459 |
RIPK2 Blocking Peptide |
DF2641-BP |
Affbiotech |
1mg |
EUR 195 |
RIPK2 Blocking Peptide |
DF6967-BP |
Affbiotech |
1mg |
EUR 195 |
RIPK2 cloning plasmid |
CSB-CL019736HU-10ug |
Cusabio |
10ug |
EUR 376 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1623
- Sequence: atgaacggggaggccatctgcagcgccctgcccaccattccctaccacaaactcgccgacctgcgctacctgagccgcggcgcctctggcactgtgtcgtccgcccgccacgcagactggcgcgtccaggtggccgtgaagcacctgcacatccacactccgctgctcgacagtg
- Show more
|
Description: A cloning plasmid for the RIPK2 gene. |
RIPK2 Blocking Peptide |
AF7618-BP |
Affbiotech |
1mg |
EUR 195 |
RIPK2 Rabbit pAb |
A2498-100ul |
Abclonal |
100 ul |
EUR 308 |
RIPK2 Rabbit pAb |
A2498-200ul |
Abclonal |
200 ul |
EUR 459 |
RIPK2 Rabbit pAb |
A2498-20ul |
Abclonal |
20 ul |
EUR 183 |
RIPK2 Rabbit pAb |
A2498-50ul |
Abclonal |
50 ul |
EUR 223 |
Polyclonal RIPK2 Antibody (C-term) |
AMR09745G |
Leading Biology |
0.1ml |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human RIPK2 (C-term). This antibody is tested and proven to work in the following applications: |
Polyclonal RIPK2 Antibody (N-term) |
AMR09748G |
Leading Biology |
0.1ml |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human RIPK2 (N-term). This antibody is tested and proven to work in the following applications: |
RIPK2 Polyclonal Antibody, Biotin Conjugated |
A54385 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: The best epigenetics products |
RIPK2 Polyclonal Antibody, FITC Conjugated |
A54386 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: kits suitable for this type of research |
RIPK2 Polyclonal Antibody, HRP Conjugated |
A54387 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: fast delivery possible |
Human RIPK2 ELISA Kit |
EHR0362 |
Abclonal |
96Tests |
EUR 521 |
Bovine RIPK2 ELISA Kit |
EBR0362 |
Abclonal |
96Tests |
EUR 521 |
Anserini RIPK2 ELISA Kit |
EAR0362 |
Abclonal |
96Tests |
EUR 521 |
Chicken RIPK2 ELISA Kit |
ECKR0362 |
Abclonal |
96Tests |
EUR 521 |
Canine RIPK2 ELISA Kit |
ECR0362 |
Abclonal |
96Tests |
EUR 521 |
Goat RIPK2 ELISA Kit |
EGTR0362 |
Abclonal |
96Tests |
EUR 521 |
RIPK2 Cell ELISA Kit |
abx595529-96tests |
Abbexa |
96 tests |
EUR 637 |
- Shipped within 1-2 weeks.
|
Human RIPK2 shRNA Plasmid |
20-abx955775 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Mouse RIPK2 shRNA Plasmid |
20-abx980440 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Porcine RIPK2 ELISA Kit |
EPR0362 |
Abclonal |
96Tests |
EUR 521 |
Sheep RIPK2 ELISA Kit |
ESR0362 |
Abclonal |
96Tests |
EUR 521 |
Rat RIPK2 ELISA Kit |
ERR0362 |
Abclonal |
96Tests |
EUR 521 |
Rabbit RIPK2 ELISA Kit |
ERTR0362 |
Abclonal |
96Tests |
EUR 521 |
Monkey RIPK2 ELISA Kit |
EMKR0362 |
Abclonal |
96Tests |
EUR 521 |
Mouse RIPK2 ELISA Kit |
EMR0362 |
Abclonal |
96Tests |
EUR 521 |
Phospho-IKK- Alpha (Ser176) /IKK- Beta (Ser177) Colorimetric Cell-Based ELISA Kit (OKAG01568) |
OKAG01568 |
Aviva Systems Biology |
2 x 96 Wells |
EUR 740 |
Description: Description of target: ;Species reactivity: Human: S176/S177, Mouse: S176/S177, Rat: S176/S177;Application: ELISA;Assay info: Assay Type: Cell-Based Subtype: Phospho Detection Method: Colorimetric 450 nm;Sensitivity: |
Monoclonal RIPK2 Antibody (monoclonal) (M02), Clone: 6F7 |
AMR09746G |
Leading Biology |
0.1mg |
EUR 484 |
Description: A Monoclonal antibody against Human RIPK2 (monoclonal) (M02). The antibodies are raised in Mouse and are from clone 6F7. This antibody is applicable in WB and IHC, E |
Monoclonal RIPK2 Antibody (monoclonal) (M05), Clone: 7F5 |
AMR09747G |
Leading Biology |
0.1mg |
EUR 484 |
Description: A Monoclonal antibody against Human RIPK2 (monoclonal) (M05). The antibodies are raised in Mouse and are from clone 7F5. This antibody is applicable in WB and IHC, E |
Guinea Pig RIPK2 ELISA Kit |
EGR0362 |
Abclonal |
96Tests |
EUR 521 |
Ripk2 ORF Vector (Rat) (pORF) |
ORF075393 |
ABM |
1.0 ug DNA |
EUR 506 |
h RIPK2 inducible lentiviral particles |
LVP222 |
GenTarget |
1x107 IFU/ml x 200ul |
EUR 451 |
Description: Pre-made tet-inducible lentiviral particles expressing a human gene with a Blasticidin-RFP fusion marker (Dual selection). The expressed human gene, RIPK2, is fully sequence verified and matched to NCBI accession ID: NM_003821 |
RIPK2 ORF Vector (Human) (pORF) |
ORF008828 |
ABM |
1.0 ug DNA |
EUR 95 |
Ripk2 ORF Vector (Mouse) (pORF) |
ORF056095 |
ABM |
1.0 ug DNA |
EUR 506 |
RIPK2 ELISA Kit (Mouse) (OKEH05329) |
OKEH05329 |
Aviva Systems Biology |
96 Wells |
EUR 662 |
Description: Description of target: Serine/threonine/tyrosine kinase that plays an essential role in modulation of innate and adaptive immune responses. Upon stimulation by bacterial peptidoglycans, NOD1 and NOD2 are activated, oligomerize and recruit RIPK2 through CARD-CARD domains. Once recruited, autophosphorylates and undergoes 'Lys-63'-linked polyubiquitination by E3 ubiquitin ligases XIAP, BIRC2 and BIRC3. The polyubiquitinated protein mediates the recruitment of MAP3K7/TAK1 to IKBKG/NEMO and induces 'Lys-63'-linked polyubiquitination of IKBKG/NEMO and subsequent activation of IKBKB/IKKB. In turn, NF-kappa-B is release from NF-kappa-B inhibitors and translocates into the nucleus where it activates the transcription of hundreds of genes involved in immune response, growth control, or protection against apoptosis. Plays also a role during engagement of the T-cell receptor (TCR) in promoting BCL10 phosphorylation and subsequent NF-kappa-B activation.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.082 ng/mL |
RIPK2 ELISA Kit (Human) (OKEH05330) |
OKEH05330 |
Aviva Systems Biology |
96 Wells |
EUR 662 |
Description: Description of target: Serine/threonine/tyrosine kinase that plays an essential role in modulation of innate and adaptive immune responses. Upon stimulation by bacterial peptidoglycans, NOD1 and NOD2 are activated, oligomerize and recruit RIPK2 through CARD-CARD domains. Contributes to the tyrosine phosphorylation of the guanine exchange factor ARHGEF2 through Src tyrosine kinase leading to NF-kappaB activation by NOD2. Once recruited, RIPK2 autophosphorylates and undergoes 'Lys-63'-linked polyubiquitination by E3 ubiquitin ligases XIAP, BIRC2 and BIRC3. The polyubiquitinated protein mediates the recruitment of MAP3K7/TAK1 to IKBKG/NEMO and induces 'Lys-63'-linked polyubiquitination of IKBKG/NEMO and subsequent activation of IKBKB/IKKB. In turn, NF-kappa-B is released from NF-kappa-B inhibitors and translocates into the nucleus where it activates the transcription of hundreds of genes involved in immune response, growth control, or protection against apoptosis. Plays also a role during engagement of the T-cell receptor (TCR) in promoting BCL10 phosphorylation and subsequent NF-kappa-B activation.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 40 pg/mL |
Receptor Interacting Serine Threonine Kinase 2 (RIPK2) Antibody |
abx027587-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
Receptor Interacting Serine Threonine Kinase 2 (RIPK2) Antibody |
abx027587-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
Receptor Interacting Serine Threonine Kinase 2 (RIPK2) Antibody |
20-abx110168 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Receptor-Interacting Serine-Threonine Kinase 2 (RIPK2) Antibody |
20-abx115090 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Receptor Interacting Serine Threonine Kinase 2 (RIPK2) Antibody |
abx037474-100ug |
Abbexa |
100 ug |
EUR 391 |
- Shipped within 5-10 working days.
|
Receptor Interacting Serine Threonine Kinase 2 (RIPK2) Antibody |
abx038405-100ug |
Abbexa |
100 ug |
EUR 391 |
- Shipped within 5-10 working days.
|
Receptor Interacting Serine Threonine Kinase 2 (RIPK2) Antibody |
20-abx130789 |
Abbexa |
-
EUR 439.00
-
EUR 133.00
-
EUR 1233.00
-
EUR 592.00
-
EUR 328.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Receptor Interacting Serine Threonine Kinase 2 (RIPK2) Antibody |
20-abx130790 |
Abbexa |
-
EUR 425.00
-
EUR 133.00
-
EUR 1177.00
-
EUR 578.00
-
EUR 328.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Receptor Interacting Serine Threonine Kinase 2 (RIPK2) Antibody |
20-abx130791 |
Abbexa |
-
EUR 411.00
-
EUR 133.00
-
EUR 1149.00
-
EUR 565.00
-
EUR 314.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Receptor Interacting Serine Threonine Kinase 2 (RIPK2) Antibody |
20-abx142197 |
Abbexa |
-
EUR 370.00
-
EUR 606.00
-
EUR 314.00
|
|
- Shipped within 5-10 working days.
|
Receptor Interacting Serine Threonine Kinase 2 (RIPK2) Antibody |
abx033703-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
Receptor Interacting Serine Threonine Kinase 2 (RIPK2) Antibody |
abx033703-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
Receptor Interacting Serine Threonine Kinase 2 (RIPK2) Antibody |
20-abx320653 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Receptor Interacting Serine Threonine Kinase 2 (RIPK2) Antibody |
abx237314-100ug |
Abbexa |
100 ug |
EUR 509 |
- Shipped within 5-12 working days.
|
Receptor Interacting Serine Threonine Kinase 2 (RIPK2) Antibody |
20-abx325914 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Receptor Interacting Serine Threonine Kinase 2 (RIPK2) Antibody |
20-abx001942 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
RIPK2 Colorimetric Cell-Based ELISA Kit |
EKC1506 |
BosterBio |
100ul |
EUR 572 |
RIPK2 (Phospho-Ser176) Antibody