RXRA Rabbit Polyclonal Antibody

RXRA Rabbit Polyclonal Antibody

To Order: garrett@bioworldantibodies.com

RXRA Polyclonal Antibody

ABP60285-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human RXRA protein at amino acid sequence of 200-280
  • Applications tips:
Description: A polyclonal antibody for detection of RXRA from Human, Mouse, Rat. This RXRA antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human RXRA protein at amino acid sequence of 200-280

RXRA Polyclonal Antibody

ES8964-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against RXRA from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

RXRA Polyclonal Antibody

ES8964-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against RXRA from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

RXRA Rabbit pAb

A15242-100ul 100 ul
EUR 308

RXRA Rabbit pAb

A15242-200ul 200 ul
EUR 459

RXRA Rabbit pAb

A15242-20ul 20 ul
EUR 183

RXRA Rabbit pAb

A15242-50ul 50 ul
EUR 223

RXRA Rabbit pAb

A3328-100ul 100 ul
EUR 308

RXRA Rabbit pAb

A3328-200ul 200 ul
EUR 459

RXRA Rabbit pAb

A3328-20ul 20 ul Ask for price

RXRA Rabbit pAb

A3328-50ul 50 ul Ask for price

Polyclonal RXRA Antibody (Center)

AMR09792G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human RXRA (Center). This antibody is tested and proven to work in the following applications:

Human Retinoid X Receptor Alpha (RXRa) ELISA Kit

DLR-RXRa-Hu-48T 48T
EUR 517
  • Should the Human Retinoid X Receptor Alpha (RXRa) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Retinoid X Receptor Alpha (RXRa) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Retinoid X Receptor Alpha (RXRa) ELISA Kit

DLR-RXRa-Hu-96T 96T
EUR 673
  • Should the Human Retinoid X Receptor Alpha (RXRa) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Retinoid X Receptor Alpha (RXRa) in samples from tissue homogenates, cell lysates or other biological fluids.

Mouse Retinoid X Receptor Alpha (RXRa) ELISA Kit

DLR-RXRa-Mu-48T 48T
EUR 527
  • Should the Mouse Retinoid X Receptor Alpha (RXRa) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Retinoid X Receptor Alpha (RXRa) in samples from tissue homogenates or other biological fluids.

Mouse Retinoid X Receptor Alpha (RXRa) ELISA Kit

DLR-RXRa-Mu-96T 96T
EUR 688
  • Should the Mouse Retinoid X Receptor Alpha (RXRa) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Retinoid X Receptor Alpha (RXRa) in samples from tissue homogenates or other biological fluids.

Human Retinoid X Receptor Alpha (RXRa) ELISA Kit

RDR-RXRa-Hu-48Tests 48 Tests
EUR 544

Human Retinoid X Receptor Alpha (RXRa) ELISA Kit

RDR-RXRa-Hu-96Tests 96 Tests
EUR 756

Mouse Retinoid X Receptor Alpha (RXRa) ELISA Kit

RDR-RXRa-Mu-48Tests 48 Tests
EUR 557

Mouse Retinoid X Receptor Alpha (RXRa) ELISA Kit

RDR-RXRa-Mu-96Tests 96 Tests
EUR 774

Human Retinoid X Receptor Alpha (RXRa) ELISA Kit

RD-RXRa-Hu-48Tests 48 Tests
EUR 521

Human Retinoid X Receptor Alpha (RXRa) ELISA Kit

RD-RXRa-Hu-96Tests 96 Tests
EUR 723

Mouse Retinoid X Receptor Alpha (RXRa) ELISA Kit

RD-RXRa-Mu-48Tests 48 Tests
EUR 533

Mouse Retinoid X Receptor Alpha (RXRa) ELISA Kit

RD-RXRa-Mu-96Tests 96 Tests
EUR 740

RXRA antibody

70R-1922 50 ug
EUR 467
Description: Rabbit polyclonal RXRA antibody raised against the N terminal of RXRA

RXRA antibody

70R-1923 50 ug
EUR 467
Description: Rabbit polyclonal RXRA antibody raised against the C terminal of RXRA

RXRA antibody

70R-1938 50 ug
EUR 467
Description: Rabbit polyclonal RXRA antibody raised against the N terminal of RXRA

RXRA antibody

70R-20052 50 ul
EUR 435
Description: Rabbit polyclonal RXRA antibody

RXRA Antibody

45310-100ul 100ul
EUR 252

RXRA Antibody

45310-50ul 50ul
EUR 187

RXRA Antibody

DF8459 200ul
EUR 304
Description: RXRA Antibody detects endogenous levels of total RXRA.

RXRA Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against RXRA. Recognizes RXRA from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

RXRA Antibody

ABD8459 100 ug
EUR 438

RXRA Conjugated Antibody

C45310 100ul
EUR 397

anti- RXRA antibody

FNab07541 100µg
EUR 548.75
  • Immunogen: retinoid X receptor, alpha
  • Uniprot ID: P19793
  • Gene ID: 6256
  • Research Area: Stem Cells, Signal Transduction, Metabolism
Description: Antibody raised against RXRA

anti- RXRA antibody

FNab07542 100µg
EUR 548.75
  • Recommended dilution: WB: 1:200-1:2000
  • IP: 1:200-1:2000
  • IHC: 1:20-1:200
  • IF: 1:10-1:100
  • Immunogen: retinoid X receptor, alpha
  • Uniprot ID: P19793
  • Gene ID: 6256
  • Research Area: Stem Cells, Signal Transduction, Metabolism
Description: Antibody raised against RXRA

anti- RXRA antibody

FNab07543 100µg
EUR 548.75
  • Recommended dilution: WB: 1:200-1:1000
  • Immunogen: retinoid X receptor, alpha
  • Uniprot ID: P19793
  • Gene ID: 6256
  • Research Area: Stem Cells, Signal Transduction, Metabolism
Description: Antibody raised against RXRA

Anti-RXRA antibody

PAab07541 100 ug
EUR 386

Anti-RXRA antibody

PAab07542 100 ug
EUR 386

Anti-RXRA antibody

STJ25427 100 µl
EUR 277
Description: Retinoid X receptors (RXRs) and retinoic acid receptors (RARs) are nuclear receptors that mediate the biological effects of retinoids by their involvement in retinoic acid-mediated gene activation. These receptors function as transcription factors by binding as homodimers or heterodimers to specific sequences in the promoters of target genes. The protein encoded by this gene is a member of the steroid and thyroid hormone receptor superfamily of transcriptional regulators. Alternative splicing of this gene results in multiple transcript variants.

Anti-RXRA antibody

STJ117436 100 µl
EUR 277
Description: Retinoid X receptors (RXRs) and retinoic acid receptors (RARs) are nuclear receptors that mediate the biological effects of retinoids by their involvement in retinoic acid-mediated gene activation. These receptors function as transcription factors by binding as homodimers or heterodimers to specific sequences in the promoters of target genes. The protein encoded by this gene is a member of the steroid and thyroid hormone receptor superfamily of transcriptional regulators. Alternative splicing of this gene results in multiple transcript variants.

Anti-RXRA antibody

STJ190122 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to RXRA

Rxra/ Rat Rxra ELISA Kit

ELI-06561r 96 Tests
EUR 886


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

RXRA Blocking Peptide

33R-2195 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of RXRA antibody, catalog no. 70R-1938

RXRA Blocking Peptide

33R-2196 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of RXRA antibody, catalog no. 70R-1922

RXRA Blocking Peptide

33R-5845 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of RXRA antibody, catalog no. 70R-1923

RXRA Blocking Peptide

DF8459-BP 1mg
EUR 195

RXRA cloning plasmid

CSB-CL020612HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 498
  • Sequence: atgcttggaagctggcctgccaggaccttccaccctggggcctgtgtcagccgccggccctccgcaccctggaagcacacggcctctgggaaggacagccctgaccttcggttttccgagcacggtgtttcccaagaattctgggctggcggcctggtggcagtgctggagatgac
  • Show more
Description: A cloning plasmid for the RXRA gene.

Anti-RXRA (3F5)

YF-MA20216 200 ul
EUR 363
Description: Mouse monoclonal to RXRA

Retinoid X Receptor Alpha (RXRA) Antibody

  • EUR 425.00
  • EUR 342.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Retinoid X Receptor Alpha (RXRa) Antibody

  • EUR 1205.00
  • EUR 578.00
  • 1 mg
  • 200 ug
  • Please enquire.

Retinoid X Receptor Alpha (RXRa) Antibody

  • EUR 1233.00
  • EUR 592.00
  • 1 mg
  • 200 ug
  • Please enquire.

Retinoid X Receptor Alpha (RXRa) Antibody

  • EUR 1233.00
  • EUR 592.00
  • 1 mg
  • 200 ug
  • Please enquire.

Retinoid X Receptor Alpha (RXRA) Antibody

abx146131-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Retinoid X Receptor Alpha (RXRa) Antibody

  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.

Retinoid X Receptor Alpha (RXRA) Antibody

abx032344-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Retinoid X Receptor Alpha (RXRA) Antibody

abx032344-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Retinoid X Receptor Alpha (RXRA) Antibody

abx237541-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

RXRA Rabbit Polyclonal Antibody

Back To Top