RXRA Rabbit Polyclonal Antibody
To Order: garrett@bioworldantibodies.com
RXRA Polyclonal Antibody |
ABP60285-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Synthesized peptide derived from part region of human RXRA protein at amino acid sequence of 200-280
- Applications tips:
|
Description: A polyclonal antibody for detection of RXRA from Human, Mouse, Rat. This RXRA antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human RXRA protein at amino acid sequence of 200-280 |
RXRA Polyclonal Antibody |
ABP60285-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from part region of human RXRA protein at amino acid sequence of 200-280
- Applications tips:
|
Description: A polyclonal antibody for detection of RXRA from Human, Mouse, Rat. This RXRA antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human RXRA protein at amino acid sequence of 200-280 |
RXRA Polyclonal Antibody |
ABP60285-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human RXRA protein at amino acid sequence of 200-280
- Applications tips:
|
Description: A polyclonal antibody for detection of RXRA from Human, Mouse, Rat. This RXRA antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human RXRA protein at amino acid sequence of 200-280 |
RXRA Rabbit pAb |
A3328-100ul |
Abclonal |
100 ul |
EUR 308 |
RXRA Rabbit pAb |
A3328-200ul |
Abclonal |
200 ul |
EUR 459 |
RXRA Rabbit pAb |
A3328-20ul |
Abclonal |
20 ul |
Ask for price |
RXRA Rabbit pAb |
A3328-50ul |
Abclonal |
50 ul |
Ask for price |
RXRA Rabbit pAb |
A15242-100ul |
Abclonal |
100 ul |
EUR 308 |
RXRA Rabbit pAb |
A15242-200ul |
Abclonal |
200 ul |
EUR 459 |
RXRA Rabbit pAb |
A15242-20ul |
Abclonal |
20 ul |
EUR 183 |
RXRA Rabbit pAb |
A15242-50ul |
Abclonal |
50 ul |
EUR 223 |
Polyclonal RXRA Antibody (Center) |
AMR09792G |
Leading Biology |
0.1ml |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human RXRA (Center). This antibody is tested and proven to work in the following applications: |
Human Retinoid X Receptor Alpha (RXRa) ELISA Kit |
DLR-RXRa-Hu-48T |
DL Develop |
48T |
EUR 517 |
- Should the Human Retinoid X Receptor Alpha (RXRa) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Retinoid X Receptor Alpha (RXRa) in samples from tissue homogenates, cell lysates or other biological fluids. |
Human Retinoid X Receptor Alpha (RXRa) ELISA Kit |
DLR-RXRa-Hu-96T |
DL Develop |
96T |
EUR 673 |
- Should the Human Retinoid X Receptor Alpha (RXRa) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Retinoid X Receptor Alpha (RXRa) in samples from tissue homogenates, cell lysates or other biological fluids. |
Mouse Retinoid X Receptor Alpha (RXRa) ELISA Kit |
DLR-RXRa-Mu-48T |
DL Develop |
48T |
EUR 527 |
- Should the Mouse Retinoid X Receptor Alpha (RXRa) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Retinoid X Receptor Alpha (RXRa) in samples from tissue homogenates or other biological fluids. |
Mouse Retinoid X Receptor Alpha (RXRa) ELISA Kit |
DLR-RXRa-Mu-96T |
DL Develop |
96T |
EUR 688 |
- Should the Mouse Retinoid X Receptor Alpha (RXRa) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Retinoid X Receptor Alpha (RXRa) in samples from tissue homogenates or other biological fluids. |
Human Retinoid X Receptor Alpha (RXRa) ELISA Kit |
RD-RXRa-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 521 |
Human Retinoid X Receptor Alpha (RXRa) ELISA Kit |
RD-RXRa-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 723 |
Mouse Retinoid X Receptor Alpha (RXRa) ELISA Kit |
RD-RXRa-Mu-48Tests |
Reddot Biotech |
48 Tests |
EUR 533 |
Mouse Retinoid X Receptor Alpha (RXRa) ELISA Kit |
RD-RXRa-Mu-96Tests |
Reddot Biotech |
96 Tests |
EUR 740 |
Human Retinoid X Receptor Alpha (RXRa) ELISA Kit |
RDR-RXRa-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 544 |
Human Retinoid X Receptor Alpha (RXRa) ELISA Kit |
RDR-RXRa-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 756 |
Mouse Retinoid X Receptor Alpha (RXRa) ELISA Kit |
RDR-RXRa-Mu-48Tests |
Reddot Biotech |
48 Tests |
EUR 557 |
Mouse Retinoid X Receptor Alpha (RXRa) ELISA Kit |
RDR-RXRa-Mu-96Tests |
Reddot Biotech |
96 Tests |
EUR 774 |
RXRA Antibody |
45310-100ul |
SAB |
100ul |
EUR 252 |
RXRA Antibody |
45310-50ul |
SAB |
50ul |
EUR 187 |
RXRA antibody |
70R-1922 |
Fitzgerald |
50 ug |
EUR 467 |
Description: Rabbit polyclonal RXRA antibody raised against the N terminal of RXRA |
RXRA antibody |
70R-1923 |
Fitzgerald |
50 ug |
EUR 467 |
Description: Rabbit polyclonal RXRA antibody raised against the C terminal of RXRA |
RXRA antibody |
70R-1938 |
Fitzgerald |
50 ug |
EUR 467 |
Description: Rabbit polyclonal RXRA antibody raised against the N terminal of RXRA |
RXRA antibody |
70R-20052 |
Fitzgerald |
50 ul |
EUR 435 |
Description: Rabbit polyclonal RXRA antibody |
RXRA Antibody |
DF8459 |
Affbiotech |
200ul |
EUR 304 |
Description: RXRA Antibody detects endogenous levels of total RXRA. |
RXRA Antibody |
1-CSB-PA020612GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
|
Description: A polyclonal antibody against RXRA. Recognizes RXRA from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB |
RXRA Conjugated Antibody |
C45310 |
SAB |
100ul |
EUR 397 |
anti- RXRA antibody |
FNab07541 |
FN Test |
100µg |
EUR 548.75 |
- Immunogen: retinoid X receptor, alpha
- Uniprot ID: P19793
- Gene ID: 6256
- Research Area: Stem Cells, Signal Transduction, Metabolism
|
Description: Antibody raised against RXRA |
anti- RXRA antibody |
FNab07542 |
FN Test |
100µg |
EUR 548.75 |
- Recommended dilution: WB: 1:200-1:2000
- IP: 1:200-1:2000
- IHC: 1:20-1:200
- IF: 1:10-1:100
- Immunogen: retinoid X receptor, alpha
- Uniprot ID: P19793
- Gene ID: 6256
- Research Area: Stem Cells, Signal Transduction, Metabolism
|
Description: Antibody raised against RXRA |
anti- RXRA antibody |
FNab07543 |
FN Test |
100µg |
EUR 548.75 |
- Recommended dilution: WB: 1:200-1:1000
- Immunogen: retinoid X receptor, alpha
- Uniprot ID: P19793
- Gene ID: 6256
- Research Area: Stem Cells, Signal Transduction, Metabolism
|
Description: Antibody raised against RXRA |
Anti-RXRA antibody |
STJ25427 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: Retinoid X receptors (RXRs) and retinoic acid receptors (RARs) are nuclear receptors that mediate the biological effects of retinoids by their involvement in retinoic acid-mediated gene activation. These receptors function as transcription factors by binding as homodimers or heterodimers to specific sequences in the promoters of target genes. The protein encoded by this gene is a member of the steroid and thyroid hormone receptor superfamily of transcriptional regulators. Alternative splicing of this gene results in multiple transcript variants. |
Anti-RXRA antibody |
STJ117436 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: Retinoid X receptors (RXRs) and retinoic acid receptors (RARs) are nuclear receptors that mediate the biological effects of retinoids by their involvement in retinoic acid-mediated gene activation. These receptors function as transcription factors by binding as homodimers or heterodimers to specific sequences in the promoters of target genes. The protein encoded by this gene is a member of the steroid and thyroid hormone receptor superfamily of transcriptional regulators. Alternative splicing of this gene results in multiple transcript variants. |
Anti-RXRA antibody |
STJ190122 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to RXRA |
RXRA siRNA |
20-abx932322 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
RXRA siRNA |
20-abx932323 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
RXRA cloning plasmid |
CSB-CL020612HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 498
- Sequence: atgcttggaagctggcctgccaggaccttccaccctggggcctgtgtcagccgccggccctccgcaccctggaagcacacggcctctgggaaggacagccctgaccttcggttttccgagcacggtgtttcccaagaattctgggctggcggcctggtggcagtgctggagatgac
- Show more
|
Description: A cloning plasmid for the RXRA gene. |
RXRA Blocking Peptide |
33R-5845 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of RXRA antibody, catalog no. 70R-1923 |
RXRA Blocking Peptide |
33R-2195 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of RXRA antibody, catalog no. 70R-1938 |
RXRA Blocking Peptide |
33R-2196 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of RXRA antibody, catalog no. 70R-1922 |
RXRA Blocking Peptide |
DF8459-BP |
Affbiotech |
1mg |
EUR 195 |
Anti-RXRA (3F5) |
YF-MA20216 |
Abfrontier |
200 ul |
EUR 363 |
Description: Mouse monoclonal to RXRA |
Retinoid X Receptor Alpha (RXRA) Antibody |
20-abx002373 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Retinoid X Receptor Alpha (RXRA) Antibody |
abx146131-100ug |
Abbexa |
100 ug |
EUR 391 |
- Shipped within 5-10 working days.
|
Retinoid X Receptor Alpha (RXRA) Antibody |
abx032344-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
Retinoid X Receptor Alpha (RXRA) Antibody |
abx032344-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
Retinoid X Receptor Alpha (RXRa) Antibody |
20-abx174393 |
Abbexa |
|
|
|
Retinoid X Receptor Alpha (RXRa) Antibody |
20-abx178260 |
Abbexa |
|
|
|
Retinoid X Receptor Alpha (RXRa) Antibody |
20-abx178261 |
Abbexa |
|
|
|
Retinoid X Receptor Alpha (RXRa) Antibody |
20-abx178262 |
Abbexa |
|
|
|
Retinoid X Receptor Alpha (RXRA) Antibody |
20-abx218409 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
RXRA Rabbit Polyclonal Antibody