SOX7 Rabbit Polyclonal Antibody

SOX7 Rabbit Polyclonal Antibody

To Order:

SOX7 Polyclonal Antibody
ABP60475-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human SOX7 protein
  • Applications tips:
Description: A polyclonal antibody for detection of SOX7 from Human, Mouse. This SOX7 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human SOX7 protein
SOX7 Polyclonal Antibody
ABP60475-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human SOX7 protein
  • Applications tips:
Description: A polyclonal antibody for detection of SOX7 from Human, Mouse. This SOX7 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human SOX7 protein
SOX7 Polyclonal Antibody
ES9090-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against SOX7 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA
SOX7 Polyclonal Antibody
ES9090-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against SOX7 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA
SOX7 Rabbit pAb
A9587-100ul 100 ul
EUR 308
SOX7 Rabbit pAb
A9587-200ul 200 ul
EUR 459
SOX7 Rabbit pAb
A9587-20ul 20 ul Ask for price
SOX7 Rabbit pAb
A9587-50ul 50 ul Ask for price
SOX7 Rabbit pAb
A14941-100ul 100 ul
EUR 308
SOX7 Rabbit pAb
A14941-200ul 200 ul
EUR 459
SOX7 Rabbit pAb
A14941-20ul 20 ul
EUR 183
SOX7 Rabbit pAb
A14941-50ul 50 ul
EUR 223
Polyclonal SOX7 Antibody (Center)
APR04774G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human SOX7 (Center). This antibody is tested and proven to work in the following applications:
SOX7 antibody
20R-1133 100 ug
EUR 377
Description: Rabbit polyclonal SOX7 antibody
SOX7 Antibody
31129-100ul 100ul
EUR 252
SOX7 Antibody
31129-50ul 50ul
EUR 187
SOX7 Antibody
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against SOX7. Recognizes SOX7 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:2000-1:10000, WB:1:1000-1:5000
SOX7 Antibody
DF8865 200ul
EUR 304
Description: SOX7 Antibody detects endogenous levels of total SOX7.
SOX7 Antibody
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against SOX7. Recognizes SOX7 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:2000-1:5000, WB:1:500-1:2000
SOX7 antibody
70R-8384 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal SOX7 antibody
SOX7 antibody
70R-8385 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal SOX7 antibody
SOX7 Antibody
ABD8865 100 ug
EUR 438
Polyclonal SOX7 Antibody (C-term)
APR04757G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human SOX7 (C-term). This antibody is tested and proven to work in the following applications:
MO15050 50 ug
EUR 252
Polyclonal SOX7 antibody - N-terminal region
APR00697G 0.1mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human SOX7 - N-terminal region. This antibody is tested and proven to work in the following applications:
SOX7 Conjugated Antibody
C31129 100ul
EUR 397
anti- SOX7 antibody
FNab08129 100µg
EUR 548.75
  • Immunogen: SRY(sex determining region Y)-box 7
  • Uniprot ID: Q9BT81
  • Gene ID: 83595
  • Research Area: Epigenetics, Stem Cells, Metabolism
Description: Antibody raised against SOX7
Anti-SOX7 Antibody
PA2285 100ug/vial
EUR 294
Anti-SOX7 antibody
PAab08129 100 ug
EUR 386
Anti-SOX7 antibody
STJ111756 100 µl
EUR 277
Description: This gene encodes a member of the SOX (SRY-related HMG-box) family of transcription factors involved in the regulation of embryonic development and in the determination of the cell fate. The encoded protein may act as a transcriptional regulator after forming a protein complex with other proteins. The protein may play a role in tumorigenesis. A similar protein in mice is involved in the regulation of the wingless-type MMTV integration site family (Wnt) pathway.
Anti-SOX7 antibody
STJ117140 100 µl
EUR 277
Description: This gene encodes a member of the SOX (SRY-related HMG-box) family of transcription factors involved in the regulation of embryonic development and in the determination of the cell fate. The encoded protein may act as a transcriptional regulator after forming a protein complex with other proteins. The protein may play a role in tumorigenesis. A similar protein in mice is involved in the regulation of the wingless-type MMTV integration site family (Wnt) pathway.
Anti-SOX7 antibody
STJ190248 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to SOX7
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
SOX7 Blocking Peptide
33R-2017 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of SOX7 antibody, catalog no. 70R-8384
SOX7 Blocking Peptide
33R-4965 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of SOX7 antibody, catalog no. 20R-1133
SOX7 Blocking Peptide
33R-5140 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of SOX7 antibody, catalog no. 70R-8385
SOX7 Blocking Peptide
DF8865-BP 1mg
EUR 195
SOX7 cloning plasmid
CSB-CL866278HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1167
  • Sequence: atggcttcgctgctgggagcctacccttggcccgagggtctcgagtgcccggccctggacgccgagctgtcggatggacaatcgccgccggccgtcccccggcccccgggggacaagggctccgagagccgtatccggcggcccatgaacgccttcatggtttgggccaaggacg
  • Show more
Description: A cloning plasmid for the SOX7 gene.
EF003145 96 Tests
EUR 689
Mouse SOX7 shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Human SOX7 shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
SOX7 Recombinant Protein (Rat)
RP230540 100 ug Ask for price
pcDNA3.1(+)-Myc-SOX7 Plasmid
PVTB00171-2a 2 ug
EUR 356
SOX7 Recombinant Protein (Human)
RP029731 100 ug Ask for price
SOX7 Recombinant Protein (Mouse)
RP174617 100 ug Ask for price
Sox7 ORF Vector (Rat) (pORF)
ORF076848 1.0 ug DNA
EUR 506
SOX7 ORF Vector (Human) (pORF)
ORF009911 1.0 ug DNA
EUR 95
Sox7 ORF Vector (Mouse) (pORF)
ORF058207 1.0 ug DNA
EUR 506
Sox7 sgRNA CRISPR Lentivector set (Rat)
K6531701 3 x 1.0 ug
EUR 339
Sox7 sgRNA CRISPR Lentivector set (Mouse)
K3424101 3 x 1.0 ug
EUR 339
SOX7 sgRNA CRISPR Lentivector set (Human)
K2260701 3 x 1.0 ug
EUR 339
Sex Determining Region Y Box Protein 7 (SOX7) Antibody
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.
Sex Determining Region Y Box Protein 7 (SOX7) Antibody
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.
Sex Determining Region Y Box Protein 7 (SOX7) Antibody
  • EUR 411.00
  • EUR 592.00
  • 100 ul
  • 200 ul
  • Shipped within 5-10 working days.
Sex Determining Region Y Box Protein 7 (SOX7) Antibody
abx238129-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.
Sox7 sgRNA CRISPR Lentivector (Rat) (Target 1)
K6531702 1.0 ug DNA
EUR 154
Sox7 sgRNA CRISPR Lentivector (Rat) (Target 2)
K6531703 1.0 ug DNA
EUR 154
Sox7 sgRNA CRISPR Lentivector (Rat) (Target 3)
K6531704 1.0 ug DNA
EUR 154
Sox7 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K3424102 1.0 ug DNA
EUR 154
Sox7 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K3424103 1.0 ug DNA
EUR 154
Sox7 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K3424104 1.0 ug DNA
EUR 154
SOX7 sgRNA CRISPR Lentivector (Human) (Target 1)
K2260702 1.0 ug DNA
EUR 154
SOX7 sgRNA CRISPR Lentivector (Human) (Target 2)
K2260703 1.0 ug DNA
EUR 154
SOX7 sgRNA CRISPR Lentivector (Human) (Target 3)
K2260704 1.0 ug DNA
EUR 154
SOX7 Protein Vector (Rat) (pPB-C-His)
PV307390 500 ng
EUR 603
SOX7 Protein Vector (Rat) (pPB-N-His)
PV307391 500 ng
EUR 603
SOX7 Protein Vector (Rat) (pPM-C-HA)
PV307392 500 ng
EUR 603
SOX7 Protein Vector (Rat) (pPM-C-His)
PV307393 500 ng
EUR 603
SOX7 Protein Vector (Human) (pPB-C-His)
PV039641 500 ng
EUR 329
SOX7 Protein Vector (Human) (pPB-N-His)
PV039642 500 ng
EUR 329
SOX7 Protein Vector (Human) (pPM-C-HA)
PV039643 500 ng
EUR 329
SOX7 Protein Vector (Human) (pPM-C-His)
PV039644 500 ng
EUR 329
SOX7 Protein Vector (Mouse) (pPB-C-His)
PV232826 500 ng
EUR 603
SOX7 Protein Vector (Mouse) (pPB-N-His)
PV232827 500 ng
EUR 603
SOX7 Protein Vector (Mouse) (pPM-C-HA)
PV232828 500 ng
EUR 603
SOX7 Protein Vector (Mouse) (pPM-C-His)
PV232829 500 ng
EUR 603
Sox7 3'UTR Luciferase Stable Cell Line
TU119493 1.0 ml Ask for price
Sox7 3'UTR GFP Stable Cell Line
TU169493 1.0 ml Ask for price
Sox7 3'UTR Luciferase Stable Cell Line
TU220995 1.0 ml Ask for price
Sox7 3'UTR GFP Stable Cell Line
TU270995 1.0 ml Ask for price
SOX7 3'UTR GFP Stable Cell Line
TU074339 1.0 ml
EUR 1521
SOX7 3'UTR Luciferase Stable Cell Line
TU024339 1.0 ml
EUR 1521
Mouse Transcription factor SOX- 7, Sox7 ELISA KIT
ELI-29104m 96 Tests
EUR 865
Human Transcription factor SOX- 7, SOX7 ELISA KIT
ELI-41403h 96 Tests
EUR 824
GAPDH Rabbit Polyclonal Antibody
37985-100ul 100ul
EUR 252
GAPDH Rabbit Polyclonal Antibody
37985-50ul 50ul
EUR 187
EFHD1 Rabbit Polyclonal Antibody
38001-100ul 100ul
EUR 252
EFHD1 Rabbit Polyclonal Antibody
38001-50ul 50ul
EUR 187
Alliinase Rabbit Polyclonal Antibody
38042-100ul 100ul
EUR 252
Alliinase Rabbit Polyclonal Antibody
38042-50ul 50ul
EUR 187
ECFP Rabbit Polyclonal Antibody
38077-100ul 100ul
EUR 252
ECFP Rabbit Polyclonal Antibody
38077-50ul 50ul
EUR 187
EYFP Rabbit Polyclonal Antibody
38078-100ul 100ul
EUR 252
EYFP Rabbit Polyclonal Antibody
38078-50ul 50ul
EUR 187
mOrange Rabbit Polyclonal Antibody
38079-100ul 100ul
EUR 252
mOrange Rabbit Polyclonal Antibody
38079-50ul 50ul
EUR 187
mStrawberry Rabbit Polyclonal Antibody
38083-100ul 100ul
EUR 252
mStrawberry Rabbit Polyclonal Antibody
38083-50ul 50ul
EUR 187
AmCyan Rabbit Polyclonal Antibody
38086-100ul 100ul
EUR 252
AmCyan Rabbit Polyclonal Antibody
38086-50ul 50ul
EUR 187
EBFP Rabbit Polyclonal Antibody
38087-100ul 100ul
EUR 252
EBFP Rabbit Polyclonal Antibody
38087-50ul 50ul
EUR 187
Vimentin Rabbit Polyclonal Antibody
38104-100ul 100ul
EUR 252
Vimentin Rabbit Polyclonal Antibody
38104-50ul 50ul
EUR 187
LDHD Rabbit Polyclonal Antibody
38105-100ul 100ul
EUR 252
LDHD Rabbit Polyclonal Antibody
38105-50ul 50ul
EUR 187
GAPDH Rabbit Polyclonal Antibody
A01021-005ml 0.05ml
EUR 147
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein
GAPDH Rabbit Polyclonal Antibody
A01021-02ml 0.2ml
EUR 332
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein
GAPDH Rabbit Polyclonal Antibody
A01021-02ml5 0.2ml×5
EUR 920
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein
Rabbit Hemoglobin Polyclonal Antibody
A53073 100 µg
EUR 570.55
Description: The best epigenetics products
Met Rabbit Polyclonal Antibody
ABP57458-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET
Met Rabbit Polyclonal Antibody
ABP57458-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET
Met Rabbit Polyclonal Antibody
ABP57458-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET
VEGF Rabbit Polyclonal Antibody
ABP57460-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA
VEGF Rabbit Polyclonal Antibody
ABP57460-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA
VEGF Rabbit Polyclonal Antibody
ABP57460-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA
CD10 Rabbit Polyclonal Antibody
ABP57461-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME
CD10 Rabbit Polyclonal Antibody
ABP57461-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME
CD10 Rabbit Polyclonal Antibody
ABP57461-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME
NM23A Rabbit Polyclonal Antibody
ABP57462-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1
NM23A Rabbit Polyclonal Antibody
ABP57462-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1
NM23A Rabbit Polyclonal Antibody
ABP57462-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1
ATM Rabbit Polyclonal Antibody
ABP57463-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM
ATM Rabbit Polyclonal Antibody
ABP57463-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM
ATM Rabbit Polyclonal Antibody
ABP57463-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM
ATM Rabbit Polyclonal Antibody
ABP57464-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM
ATM Rabbit Polyclonal Antibody
ABP57464-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM
ATM Rabbit Polyclonal Antibody
ABP57464-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM
HSC70 Rabbit Polyclonal Antibody
ABP57565-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
  • Applications tips:
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
HSC70 Rabbit Polyclonal Antibody
ABP57565-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
  • Applications tips:
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
HSC70 Rabbit Polyclonal Antibody
ABP57565-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
  • Applications tips:
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
HSP40 Rabbit Polyclonal Antibody
ABP57566-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of HSP40
  • Applications tips:
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40
HSP40 Rabbit Polyclonal Antibody
ABP57566-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of HSP40
  • Applications tips:
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40
HSP40 Rabbit Polyclonal Antibody
ABP57566-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of HSP40
  • Applications tips:
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40
HSP90Alpha Rabbit Polyclonal Antibody
ABP57567-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of HSP90?
  • Applications tips:
Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90?
HSP90Alpha Rabbit Polyclonal Antibody
ABP57567-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of HSP90?
  • Applications tips:
Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90?
HSP90Alpha Rabbit Polyclonal Antibody
ABP57567-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of HSP90?
  • Applications tips:
Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90?
JAK1 Rabbit Polyclonal Antibody
ABP57569-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of JAK1
  • Applications tips:
Description: A polyclonal antibody for detection of JAK1 from Human, Mouse, Rat. This JAK1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK1
JAK1 Rabbit Polyclonal Antibody
ABP57569-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of JAK1
  • Applications tips:
Description: A polyclonal antibody for detection of JAK1 from Human, Mouse, Rat. This JAK1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK1
JAK1 Rabbit Polyclonal Antibody
ABP57569-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of JAK1
  • Applications tips:
Description: A polyclonal antibody for detection of JAK1 from Human, Mouse, Rat. This JAK1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK1
JAK2 Rabbit Polyclonal Antibody
ABP57570-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of JAK2
  • Applications tips:
Description: A polyclonal antibody for detection of JAK2 from Human, Mouse, Rat. This JAK2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK2
JAK2 Rabbit Polyclonal Antibody
ABP57570-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of JAK2
  • Applications tips:
Description: A polyclonal antibody for detection of JAK2 from Human, Mouse, Rat. This JAK2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK2
JAK2 Rabbit Polyclonal Antibody
ABP57570-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of JAK2
  • Applications tips:
Description: A polyclonal antibody for detection of JAK2 from Human, Mouse, Rat. This JAK2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK2
JNK2 Rabbit Polyclonal Antibody
ABP57571-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of JNK2
  • Applications tips:
Description: A polyclonal antibody for detection of JNK2 from Human, Mouse, Rat. This JNK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK2
JNK2 Rabbit Polyclonal Antibody
ABP57571-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of JNK2
  • Applications tips:
Description: A polyclonal antibody for detection of JNK2 from Human, Mouse, Rat. This JNK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK2
JNK2 Rabbit Polyclonal Antibody
ABP57571-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of JNK2
  • Applications tips:
Description: A polyclonal antibody for detection of JNK2 from Human, Mouse, Rat. This JNK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK2
JNK3 Rabbit Polyclonal Antibody
ABP57572-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of JNK3
  • Applications tips:
Description: A polyclonal antibody for detection of JNK3 from Human, Mouse, Rat. This JNK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK3
JNK3 Rabbit Polyclonal Antibody
ABP57572-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of JNK3
  • Applications tips:
Description: A polyclonal antibody for detection of JNK3 from Human, Mouse, Rat. This JNK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK3
JNK3 Rabbit Polyclonal Antibody
ABP57572-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of JNK3
  • Applications tips:
Description: A polyclonal antibody for detection of JNK3 from Human, Mouse, Rat. This JNK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK3
MEK2 Rabbit Polyclonal Antibody
ABP57573-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of MEK2
  • Applications tips:
Description: A polyclonal antibody for detection of MEK2 from Human. This MEK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of MEK2
MEK2 Rabbit Polyclonal Antibody
ABP57573-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of MEK2
  • Applications tips:
Description: A polyclonal antibody for detection of MEK2 from Human. This MEK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of MEK2
MEK2 Rabbit Polyclonal Antibody
ABP57573-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of MEK2
  • Applications tips:
Description: A polyclonal antibody for detection of MEK2 from Human. This MEK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of MEK2
MEK3 Rabbit Polyclonal Antibody
ABP57574-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of MEK3
  • Applications tips:
Description: A polyclonal antibody for detection of MEK3 from Human, Mouse, Rat. This MEK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of MEK3
MEK3 Rabbit Polyclonal Antibody
ABP57574-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of MEK3
  • Applications tips:
Description: A polyclonal antibody for detection of MEK3 from Human, Mouse, Rat. This MEK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of MEK3
MEK3 Rabbit Polyclonal Antibody
ABP57574-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of MEK3
  • Applications tips:
Description: A polyclonal antibody for detection of MEK3 from Human, Mouse, Rat. This MEK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of MEK3
Nrf2 Rabbit Polyclonal Antibody
ABP57575-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of Nrf2
  • Applications tips:
Description: A polyclonal antibody for detection of Nrf2 from Human, Mouse, Rat. This Nrf2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Nrf2
Nrf2 Rabbit Polyclonal Antibody
ABP57575-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of Nrf2
  • Applications tips:
Description: A polyclonal antibody for detection of Nrf2 from Human, Mouse, Rat. This Nrf2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Nrf2
Nrf2 Rabbit Polyclonal Antibody
ABP57575-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of Nrf2
  • Applications tips:
Description: A polyclonal antibody for detection of Nrf2 from Human, Mouse, Rat. This Nrf2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Nrf2
ATG4a Rabbit Polyclonal Antibody
ABP57576-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of ATG4a
  • Applications tips:
Description: A polyclonal antibody for detection of ATG4a from Human, Mouse, Rat. This ATG4a antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG4a
ATG4a Rabbit Polyclonal Antibody
ABP57576-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of ATG4a
  • Applications tips:
Description: A polyclonal antibody for detection of ATG4a from Human, Mouse, Rat. This ATG4a antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG4a
ATG4a Rabbit Polyclonal Antibody
ABP57576-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of ATG4a
  • Applications tips:
Description: A polyclonal antibody for detection of ATG4a from Human, Mouse, Rat. This ATG4a antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG4a
ATG4b Rabbit Polyclonal Antibody
ABP57577-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of ATG4b
  • Applications tips:
Description: A polyclonal antibody for detection of ATG4b from Human, Mouse, Rat. This ATG4b antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG4b
ATG4b Rabbit Polyclonal Antibody
ABP57577-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of ATG4b
  • Applications tips:
Description: A polyclonal antibody for detection of ATG4b from Human, Mouse, Rat. This ATG4b antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG4b
ATG4b Rabbit Polyclonal Antibody
ABP57577-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of ATG4b
  • Applications tips:
Description: A polyclonal antibody for detection of ATG4b from Human, Mouse, Rat. This ATG4b antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG4b
ATG4c Rabbit Polyclonal Antibody
ABP57578-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of ATG4c
  • Applications tips:
Description: A polyclonal antibody for detection of ATG4c from Human, Mouse, Rat. This ATG4c antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG4c
ATG4c Rabbit Polyclonal Antibody
ABP57578-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of ATG4c
  • Applications tips:
Description: A polyclonal antibody for detection of ATG4c from Human, Mouse, Rat. This ATG4c antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG4c
ATG4c Rabbit Polyclonal Antibody
ABP57578-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of ATG4c
  • Applications tips:
Description: A polyclonal antibody for detection of ATG4c from Human, Mouse, Rat. This ATG4c antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG4c
ATG5 Rabbit Polyclonal Antibody
ABP57579-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of ATG5
  • Applications tips:
Description: A polyclonal antibody for detection of ATG5 from Human, Mouse, Rat. This ATG5 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG5
ATG5 Rabbit Polyclonal Antibody
ABP57579-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of ATG5
  • Applications tips:
Description: A polyclonal antibody for detection of ATG5 from Human, Mouse, Rat. This ATG5 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG5
ATG5 Rabbit Polyclonal Antibody
ABP57579-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of ATG5
  • Applications tips:
Description: A polyclonal antibody for detection of ATG5 from Human, Mouse, Rat. This ATG5 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG5
ATG7 Rabbit Polyclonal Antibody
ABP57580-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of ATG7
  • Applications tips:
Description: A polyclonal antibody for detection of ATG7 from Human, Mouse, Rat. This ATG7 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG7
ATG7 Rabbit Polyclonal Antibody
ABP57580-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of ATG7
  • Applications tips:
Description: A polyclonal antibody for detection of ATG7 from Human, Mouse, Rat. This ATG7 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG7
ATG7 Rabbit Polyclonal Antibody
ABP57580-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of ATG7
  • Applications tips:
Description: A polyclonal antibody for detection of ATG7 from Human, Mouse, Rat. This ATG7 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG7
ATG13 Rabbit Polyclonal Antibody
ABP57581-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of ATG13
  • Applications tips:
Description: A polyclonal antibody for detection of ATG13 from Human, Mouse, Rat. This ATG13 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG13
ATG13 Rabbit Polyclonal Antibody
ABP57581-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of ATG13
  • Applications tips:
Description: A polyclonal antibody for detection of ATG13 from Human, Mouse, Rat. This ATG13 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG13
ATG13 Rabbit Polyclonal Antibody
ABP57581-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of ATG13
  • Applications tips:
Description: A polyclonal antibody for detection of ATG13 from Human, Mouse, Rat. This ATG13 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG13
ATG13 Rabbit Polyclonal Antibody
ABP57582-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of ATG13
  • Applications tips:
Description: A polyclonal antibody for detection of ATG13 from Human, Mouse, Rat. This ATG13 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG13
ATG13 Rabbit Polyclonal Antibody
ABP57582-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of ATG13
  • Applications tips:
Description: A polyclonal antibody for detection of ATG13 from Human, Mouse, Rat. This ATG13 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG13
ATG13 Rabbit Polyclonal Antibody
ABP57582-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of ATG13
  • Applications tips:
Description: A polyclonal antibody for detection of ATG13 from Human, Mouse, Rat. This ATG13 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG13
ATG14L Rabbit Polyclonal Antibody
ABP57583-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of ATG14L
  • Applications tips:
Description: A polyclonal antibody for detection of ATG14L from Human, Mouse, Rat. This ATG14L antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG14L
ATG14L Rabbit Polyclonal Antibody
ABP57583-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of ATG14L
  • Applications tips:
Description: A polyclonal antibody for detection of ATG14L from Human, Mouse, Rat. This ATG14L antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG14L
ATG14L Rabbit Polyclonal Antibody
ABP57583-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of ATG14L
  • Applications tips:
Description: A polyclonal antibody for detection of ATG14L from Human, Mouse, Rat. This ATG14L antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG14L
NBR1 Rabbit Polyclonal Antibody
ABP57585-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of NBR1
  • Applications tips:
Description: A polyclonal antibody for detection of NBR1 from Human, Mouse, Rat. This NBR1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NBR1
NBR1 Rabbit Polyclonal Antibody
ABP57585-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of NBR1
  • Applications tips:
Description: A polyclonal antibody for detection of NBR1 from Human, Mouse, Rat. This NBR1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NBR1
NBR1 Rabbit Polyclonal Antibody
ABP57585-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of NBR1
  • Applications tips:
Description: A polyclonal antibody for detection of NBR1 from Human, Mouse, Rat. This NBR1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NBR1

SOX7 Rabbit Polyclonal Antibody

Back To Top