SPHK1 Rabbit Polyclonal Antibody

SPHK1 Rabbit Polyclonal Antibody

To Order: garrett@bioworldantibodies.com

SPHK1 Polyclonal Antibody

ABP60494-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human SPHK1 protein at amino acid sequence of 160-240
  • Applications tips:
Description: A polyclonal antibody for detection of SPHK1 from Human. This SPHK1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human SPHK1 protein at amino acid sequence of 160-240

SPHK1 Polyclonal Antibody

ABP60494-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human SPHK1 protein at amino acid sequence of 160-240
  • Applications tips:
Description: A polyclonal antibody for detection of SPHK1 from Human. This SPHK1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human SPHK1 protein at amino acid sequence of 160-240

SPHK1 Polyclonal Antibody

ABP60494-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human SPHK1 protein at amino acid sequence of 160-240
  • Applications tips:
Description: A polyclonal antibody for detection of SPHK1 from Human. This SPHK1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human SPHK1 protein at amino acid sequence of 160-240

Human Sphingosine Kinase 1 (SPHK1) ELISA Kit

DLR-SPHK1-Hu-48T 48T
EUR 517
  • Should the Human Sphingosine Kinase 1 (SPHK1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Sphingosine Kinase 1 (SPHK1) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Sphingosine Kinase 1 (SPHK1) ELISA Kit

DLR-SPHK1-Hu-96T 96T
EUR 673
  • Should the Human Sphingosine Kinase 1 (SPHK1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Sphingosine Kinase 1 (SPHK1) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Sphingosine Kinase 1 (SPHK1) ELISA Kit

RD-SPHK1-Hu-48Tests 48 Tests
EUR 521

Human Sphingosine Kinase 1 (SPHK1) ELISA Kit

RD-SPHK1-Hu-96Tests 96 Tests
EUR 723

Human Sphingosine Kinase 1 (SPHK1) ELISA Kit

RDR-SPHK1-Hu-48Tests 48 Tests
EUR 544

Human Sphingosine Kinase 1 (SPHK1) ELISA Kit

RDR-SPHK1-Hu-96Tests 96 Tests
EUR 756

SPHK1 Rabbit pAb

A0139-100ul 100 ul
EUR 308

SPHK1 Rabbit pAb

A0139-200ul 200 ul
EUR 459

SPHK1 Rabbit pAb

A0139-20ul 20 ul
EUR 183

SPHK1 Rabbit pAb

A0139-50ul 50 ul
EUR 223

SPHK1 Rabbit pAb

A0660-100ul 100 ul
EUR 308

SPHK1 Rabbit pAb

A0660-200ul 200 ul
EUR 459

SPHK1 Rabbit pAb

A0660-20ul 20 ul
EUR 183

SPHK1 Rabbit pAb

A0660-50ul 50 ul
EUR 223

Polyclonal SPHK1 Antibody (Center)

APR06976G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human SPHK1 (Center). This antibody is tested and proven to work in the following applications:

Polyclonal SPHK1 antibody - middle region

APR10218G 0.05mg
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human SPHK1 - middle region. This antibody is tested and proven to work in the following applications:

Polyclonal SPHK1 Antibody (N-term)

APR10830G 0.1ml
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human SPHK1 (N-term). This antibody is tested and proven to work in the following applications:

Polyclonal Goat Anti-SPHK1 Antibody

APR07129G 0.1 mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human Goat Anti-SPHK1 . This antibody is tested and proven to work in the following applications:

SPHK1 Antibody

ABD6005 100 ug
EUR 438

SPHK1 Antibody

49581-100ul 100ul
EUR 333

SPHK1 Antibody

49581-50ul 50ul
EUR 239

SPHK1 Antibody

32004-100ul 100ul
EUR 252

SPHK1 antibody

20R-SR023 50 ug
EUR 656
Description: Rabbit polyclonal SPHK1 antibody

SPHK1 antibody

20R-SR024 50 ug
EUR 656
Description: Rabbit polyclonal SPHK1 antibody

SPHK1 antibody

70R-20491 50 ul
EUR 435
Description: Rabbit polyclonal SPHK1 antibody

SPHK1 Antibody

DF6005 200ul
EUR 304
Description: SPHK1 Antibody detects endogenous levels of total SPHK1.

SPHK1 Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against SPHK1. Recognizes SPHK1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC

SPHK1 Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SPHK1. Recognizes SPHK1 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:2000-1:5000, IHC:1:20-1:200, IF:1:50-1:200

Polyclonal SPHK / SPHK1 Antibody (N-Terminus)

APR10216G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human SPHK / SPHK1 (N-Terminus). This antibody is tested and proven to work in the following applications:

Polyclonal SPHK / SPHK1 Antibody (N-Terminus)

APR10217G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human SPHK / SPHK1 (N-Terminus). This antibody is tested and proven to work in the following applications:

Polyclonal SPHK1 Antibody (N-term P74)

APR07043G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human SPHK1 (N-term P74). This antibody is tested and proven to work in the following applications:

SPHK1 (Phospho-Ser225) Polyclonal Conjugated Antibody

C12639 100ul
EUR 397

Sphingosine kinase I (SPHK1) polyclonal antibody

ABP-PAB-11348 100 ug Ask for price
    • Product line: Kinases
    • Brand:

SPHK1 Conjugated Antibody

C49581 100ul
EUR 397

SPHK1 Conjugated Antibody

C32004 100ul
EUR 397

anti- SPHK1 antibody

FNab08173 100µg
EUR 548.75
  • Recommended dilution: WB: 1:500 - 1:2000
  • IHC: 1:50 - 1:200
  • Immunogen: sphingosine kinase 1
  • Uniprot ID: Q9NYA1
  • Gene ID: 8877
  • Research Area: Cardiovascular, Signal Transduction
Description: Antibody raised against SPHK1

SPHK1 (pS225) Antibody

abx218735-100ug 100 ug
EUR 439
  • Shipped within 5-10 working days.

Anti-SPHK1 antibody

PAab08173 100 ug
EUR 386

Anti-SPHK1 Antibody

PA1996 100ug/vial
EUR 334

Anti-SPHK1 Antibody

STJ503116 100 µg
EUR 476

Anti-SPHK1 antibody

STJ71503 100 µg
EUR 359

Anti-SPHK1 antibody

STJ25673 100 µl
EUR 277
Description: The protein encoded by this gene catalyzes the phosphorylation of sphingosine to form sphingosine-1-phosphate (S1P), a lipid mediator with both intra- and extracellular functions. Intracellularly, S1P regulates proliferation and survival, and extracellularly, it is a ligand for cell surface G protein-coupled receptors. This protein, and its product S1P, play a key role in TNF-alpha signaling and the NF-kappa-B activation pathway important in inflammatory, antiapoptotic, and immune processes. Alternatively spliced transcript variants encoding different isoforms have been found for this gene.

Anti-SPHK1 antibody

STJ114892 100 µl
EUR 277
Description: The protein encoded by this gene catalyzes the phosphorylation of sphingosine to form sphingosine-1-phosphate (S1P), a lipid mediator with both intra- and extracellular functions. Intracellularly, S1P regulates proliferation and survival, and extracellularly, it is a ligand for cell surface G protein-coupled receptors. This protein, and its product S1P, play a key role in TNF-alpha signaling and the NF-kappa-B activation pathway important in inflammatory, antiapoptotic, and immune processes. Alternatively spliced transcript variants encoding different isoforms have been found for this gene.

Anti-SPHK1 antibody

STJ190139 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to SPHK1

Sphk1/ Rat Sphk1 ELISA Kit

ELI-06936r 96 Tests
EUR 886


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


YF-PA15947 50 ug
EUR 363
Description: Mouse polyclonal to SPHK1


YF-PA15948 100 ul
EUR 403
Description: Rabbit polyclonal to SPHK1


YF-PA15949 100 ug
EUR 403
Description: Rabbit polyclonal to SPHK1


YF-PA25219 50 ul
EUR 334
Description: Mouse polyclonal to SPHK1

Phospho-SPHK1 (Ser225) Antibody

AF8318 200ul
EUR 376
Description: SPHK1 (Phospho-Ser225) Antibody detects endogenous levels of SPHK1 only when phosphorylated at Ser225.

SPHK1 (Phospho- Ser225) Antibody

ABF8318 100 ug
EUR 438

SPHK1 (Phospho-Ser225) Antibody

12639-100ul 100ul
EUR 252

SPHK1 (Phospho-Ser225) Antibody

12639-50ul 50ul
EUR 187

SPHK1 Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SPHK1. Recognizes SPHK1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

SPHK1 Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SPHK1. Recognizes SPHK1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

SPHK1 Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SPHK1. Recognizes SPHK1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Anti-SPHK1 Monoclonal Antibody

M01390 100ug
EUR 397
Description: Rabbit Monoclonal SPHK1 Antibody. Validated in Flow Cytometry, WB and tested in Human, Mouse, Rat.

Anti-SPHK1 Antibody BIOTIN

STJ503117 100 µg
EUR 586

Anti-SPHK1 Antibody FITC

STJ503118 100 µg
EUR 586

Sphingosine Kinase 1 (SPHK1) Polyclonal Antibody (Human, Mouse)

  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SPHK1 (Leu148~Leu398)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Sphingosine Kinase 1 (SPHK1)

SPHK1 cloning plasmid

CSB-CL022564HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1197
  • Sequence: atggatccagtggtcggttgcggacgtggcctctttggttttgttttctcagcgggcggcccccggggcgtgctcccgcggccctgccgcgtgctggtgctgctgaacccgcgcggcggcaagggcaaggccttgcagctcttccggagtcacgtgcagccccttttggctgagg
  • Show more
Description: A cloning plasmid for the SPHK1 gene.

SPHK1 cloning plasmid

CSB-CL022564HU2-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1155
  • Sequence: atggatccagcgggcggcccccggggcgtgctcccgcggccctgccgcgtgctggtgctgctgaacccgcgcggcggcaagggcaaggccttgcagctcttccggagtcacgtgcagccccttttggctgaggctgaaatctccttcacgctgatgctcactgagcggcggaacc
  • Show more
Description: A cloning plasmid for the SPHK1 gene.

SPHK1 cloning plasmid

CSB-CL022564HU3-10ug 10ug
EUR 506
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1413
  • Sequence: atgtccgctcaagttctgggatttttacgcagctggactcccctccccctggcagccccgaggggtccagccgccgcagggaatgacgccggtgctcctacagccacggctccgggcggggaaggcgagccccacagccggccctgcgacgcccgcctgggcagcaccgataagg
  • Show more
Description: A cloning plasmid for the SPHK1 gene.

SPHK1 cloning plasmid

CSB-CL022564HU4-10ug 10ug
EUR 506
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1413
  • Sequence: atgtccgctcaagttctgggatttttacgcagctggactcccctccccctggcagccccgaggggtccagccgccgcagggaatgacgccggtgctcctacagccacggctccgggcggggaaggcgagccccacagccggccctgcgacgcccgcctgggcagcaccgataagg
  • Show more
Description: A cloning plasmid for the SPHK1 gene.

SPHK1 Blocking Peptide

DF6005-BP 1mg
EUR 195

Anti-SPHK1 (2A8)

YF-MA16585 100 ug
EUR 363
Description: Mouse monoclonal to SPHK1

Anti-SPHK1 (1D6)

YF-MA11127 100 ug
EUR 363
Description: Mouse monoclonal to SPHK1

anti- SPHK1-Phospho-Ser225 antibody

FNab08174 100µg
EUR 585
  • Immunogen: sphingosine kinase 1
  • Uniprot ID: Q9NYA1
  • Research Area: Cardiovascular, Signal Transduction
Description: Antibody raised against SPHK1-Phospho-Ser225

Sphingosine Kinase 1 (SPHK1) Antibody

  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Sphingosine Kinase 1 (SPHK1) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Sphingosine Kinase 1 (SPHK1) Antibody

  • EUR 370.00
  • EUR 606.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.

SPHK1 Rabbit Polyclonal Antibody

Back To Top