STK38 Rabbit Polyclonal Antibody

STK38 Rabbit Polyclonal Antibody

To Order:

STK38 Polyclonal Antibody

ABP60543-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human STK38 protein at amino acid sequence of 390-470
  • Applications tips:
Description: A polyclonal antibody for detection of STK38 from Human, Mouse. This STK38 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human STK38 protein at amino acid sequence of 390-470

STK38 Polyclonal Antibody

ABP60544-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human STK38 protein at amino acid sequence of 220-300
  • Applications tips:
Description: A polyclonal antibody for detection of STK38 from Human, Mouse. This STK38 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human STK38 protein at amino acid sequence of 220-300

STK38 Polyclonal Antibody

ABP60544-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human STK38 protein at amino acid sequence of 220-300
  • Applications tips:
Description: A polyclonal antibody for detection of STK38 from Human, Mouse. This STK38 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human STK38 protein at amino acid sequence of 220-300

STK38 Polyclonal Antibody

ABP60544-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human STK38 protein at amino acid sequence of 220-300
  • Applications tips:
Description: A polyclonal antibody for detection of STK38 from Human, Mouse. This STK38 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human STK38 protein at amino acid sequence of 220-300

STK38 Polyclonal Antibody

ES8954-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against STK38 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

STK38 Polyclonal Antibody

ES8954-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against STK38 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

STK38 Polyclonal Antibody

ES10204-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against STK38 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

STK38 Polyclonal Antibody

ES10204-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against STK38 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

STK38 Rabbit pAb

A8191-100ul 100 ul
EUR 308

STK38 Rabbit pAb

A8191-200ul 200 ul
EUR 459

STK38 Rabbit pAb

A8191-20ul 20 ul
EUR 183

STK38 Rabbit pAb

A8191-50ul 50 ul
EUR 223

Polyclonal STK38 Antibody (Internal)

APG01192G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human STK38 (Internal). This antibody is tested and proven to work in the following applications:

STK38 Polyclonal Conjugated Antibody

C31463 100ul
EUR 397

STK38 antibody

70R-20601 50 ul
EUR 435
Description: Rabbit polyclonal STK38 antibody

STK38 Antibody

  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against STK38. Recognizes STK38 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

STK38 antibody

70R-5769 50 ug
EUR 467
Description: Rabbit polyclonal STK38 antibody raised against the C terminal of STK38

STK38 Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against STK38. Recognizes STK38 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

Polyclonal Mouse Stk38 Antibody (C-term)

APR04403G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human Mouse Stk38 (C-term). This antibody is tested and proven to work in the following applications:

anti- STK38 antibody

FNab08336 100µg
EUR 585
  • Immunogen: serine/threonine kinase 38
  • Uniprot ID: Q15208
  • Gene ID: 11329
  • Research Area: Signal Transduction, Metabolism
Description: Antibody raised against STK38

anti- STK38 antibody

FNab08337 100µg
EUR 585
  • Immunogen: serine/threonine kinase 38
  • Uniprot ID: Q15208
  • Gene ID: 11329
  • Research Area: Signal Transduction, Metabolism
Description: Antibody raised against STK38

Anti-STK38 antibody

PAab08336 100 ug
EUR 412

Anti-STK38 antibody

PAab08337 100 ug
EUR 412

Anti-STK38 antibody

STJ110490 100 µl
EUR 277
Description: This gene encodes a member of the AGC serine/threonine kinase family of proteins. The kinase activity of this protein is regulated by autophosphorylation and phosphorylation by other upstream kinases. This protein has been shown to function in the cell cycle and apoptosis. This protein has also been found to regulate the protein stability and transcriptional activity of the MYC oncogene. Alternative splicing results in multiple transcript variants.

Anti-STK38 antibody

STJ190112 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to STK38

Anti-STK38 antibody

STJ191362 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to STK38


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


YF-PA17594 100 ug
EUR 403
Description: Rabbit polyclonal to STK38


YF-PA25788 50 ul
EUR 334
Description: Mouse polyclonal to STK38

Polyclonal NDR1 / STK38 Antibody (C-Term, near)

APG00748G 0.1mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human NDR1 / STK38 (C-Term, near). This antibody is tested and proven to work in the following applications:

Anti-NDR1 / STK38 antibody

STJ72524 100 µg
EUR 359

Polyclonal NDR1 / STK38 (aa362-377) Antibody (internal region)

APG00749G 0.1mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human NDR1 / STK38 (aa362-377) (internal region). This antibody is tested and proven to work in the following applications:

STK38 Blocking Peptide

33R-3966 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of STK38 antibody, catalog no. 70R-5769

STK38 cloning plasmid

CSB-CL614885HU-10ug 10ug
EUR 502
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1398
  • Sequence: atggcaatgacaggctcaacaccttgctcatccatgagtaaccacacaaaggaaagggtgacaatgaccaaagtgacactggagaatttttatagcaaccttatcgctcaacatgaagaacgagaaatgagacaaaagaagttagaaaaggtgatggaagaagaaggcctaaaag
  • Show more
Description: A cloning plasmid for the STK38 gene.

Anti-STK38 (3A5)

YF-MA11363 100 ug
EUR 363
Description: Mouse monoclonal to STK38

Anti-STK38 (6F1)

YF-MA11364 100 ug
EUR 363
Description: Mouse monoclonal to STK38

Anti-STK38 (2F6)

YF-MA11365 50 ug
EUR 363
Description: Mouse monoclonal to STK38

Anti-STK38 (2F3)

YF-MA17716 100 ug
EUR 363
Description: Mouse monoclonal to STK38

Anti-STK38 (6G11)

YF-MA17717 100 ug
EUR 363
Description: Mouse monoclonal to STK38

Anti-STK38 (2F6)

YF-MA17718 200 ul
EUR 363
Description: Mouse monoclonal to STK38


EF003316 96 Tests
EUR 689

Human STK38 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse STK38 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

STK38 Recombinant Protein (Rat)

RP231482 100 ug Ask for price

STK38 Recombinant Protein (Human)

RP030433 100 ug Ask for price

STK38 Recombinant Protein (Mouse)

RP176096 100 ug Ask for price

Anti-STK38 (2G8-1F3)

YF-MA11362 50 ug
EUR 363
Description: Mouse monoclonal to STK38

Anti-STK38 (2G8-1F3)

YF-MA17715 200 ul
EUR 363
Description: Mouse monoclonal to STK38

Serine/Threonine Kinase 38 (STK38) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

STK38 Rabbit Polyclonal Antibody

Back To Top