TLR5 Rabbit Polyclonal Antibody

TLR5 Rabbit Polyclonal Antibody

To Order: garrett@bioworldantibodies.com

TLR5 Polyclonal Antibody
ES8984-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against TLR5 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

TLR5 Polyclonal Antibody
ABP60699-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human TLR5 protein at amino acid sequence of 730-810
  • Applications tips:
Description: A polyclonal antibody for detection of TLR5 from Human, Mouse. This TLR5 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human TLR5 protein at amino acid sequence of 730-810

TLR5 Polyclonal Antibody
ABP60699-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human TLR5 protein at amino acid sequence of 730-810
  • Applications tips:
Description: A polyclonal antibody for detection of TLR5 from Human, Mouse. This TLR5 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human TLR5 protein at amino acid sequence of 730-810

TLR5 Polyclonal Antibody
ABP60699-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human TLR5 protein at amino acid sequence of 730-810
  • Applications tips:
Description: A polyclonal antibody for detection of TLR5 from Human, Mouse. This TLR5 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human TLR5 protein at amino acid sequence of 730-810

Human Toll Like Receptor 5 (TLR5) ELISA Kit
DLR-TLR5-Hu-48T 48T
EUR 498
  • Should the Human Toll Like Receptor 5 (TLR5) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Toll Like Receptor 5 (TLR5) in samples from tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Human Toll Like Receptor 5 (TLR5) ELISA Kit
DLR-TLR5-Hu-96T 96T
EUR 647
  • Should the Human Toll Like Receptor 5 (TLR5) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Toll Like Receptor 5 (TLR5) in samples from tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Human Toll Like Receptor 5 (TLR5) ELISA Kit
RDR-TLR5-Hu-48Tests 48 Tests
EUR 522

Human Toll Like Receptor 5 (TLR5) ELISA Kit
RDR-TLR5-Hu-96Tests 96 Tests
EUR 724

Human Toll Like Receptor 5 (TLR5) ELISA Kit
RD-TLR5-Hu-48Tests 48 Tests
EUR 500

Human Toll Like Receptor 5 (TLR5) ELISA Kit
RD-TLR5-Hu-96Tests 96 Tests
EUR 692

TLR5 Rabbit pAb
A1721-100ul 100 ul
EUR 308

TLR5 Rabbit pAb
A1721-200ul 200 ul
EUR 459

TLR5 Rabbit pAb
A1721-20ul 20 ul
EUR 183

TLR5 Rabbit pAb
A1721-50ul 50 ul
EUR 223

Polyclonal TLR5 Antibody (Internal)
APR02281G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human TLR5 (Internal). This antibody is tested and proven to work in the following applications:

Anti-TLR5 Rabbit Monoclonal Antibody
M00462 100ug/vial
EUR 397
Description: Rabbit Monoclonal TLR5 Antibody. Validated in WB and tested in Human, Mouse, Rat.

Polyclonal TLR5 Antibody (C-Terminus)
APR02388G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human TLR5 (C-Terminus). This antibody is tested and proven to work in the following applications:

Polyclonal TLR5 Antibody (aa300-350)
APR02821G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human TLR5 (aa300-350). This antibody is tested and proven to work in the following applications:

TLR5 Antibody
AF7634 200ul
EUR 376
Description: TLR5 Antibody detects endogenous levels of TLR5.

TLR5 antibody
70R-20850 50 ul
EUR 435
Description: Rabbit polyclonal TLR5 antibody

TLR5 antibody
70R-5979 50 ug
EUR 467
Description: Rabbit polyclonal TLR5 antibody raised against the N terminal of TLR5

TLR5 Antibody
ABD6575 100 ug
EUR 438

TLR5 Antibody
35397-100ul 100ul
EUR 390

TLR5 Antibody
3555R-100
EUR 316

TLR5 Antibody
3555R-30T
EUR 146

TLR5 Antibody
36165-100ul 100ul
EUR 252

TLR5 antibody
38286-100ul 100ul
EUR 252

TLR5 Antibody
49443-100ul 100ul
EUR 333

TLR5 Antibody
49443-50ul 50ul
EUR 239

TLR5 Antibody
24365-100ul 100ul
EUR 390

TLR5 Antibody
24366-100ul 100ul
EUR 390

TLR5 antibody
20R-1640 100 ug
EUR 673
Description: Rabbit polyclonal TLR5 antibody

TLR5 antibody
70R-11906 100 ug
EUR 403
Description: Rabbit polyclonal TLR5 antibody

TLR5 Antibody
DF6575 200ul
EUR 304
Description: TLR5 Antibody detects endogenous levels of total TLR5.

TLR5 Antibody
1-CSB-PA296982
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against TLR5. Recognizes TLR5 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:5000, IHC:1:50-1:200

TLR5 Antibody
1-CSB-PA218621
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against TLR5. Recognizes TLR5 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:5000, IHC:1:50-1:200

TLR5 Antibody
1-CSB-PA023604GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against TLR5. Recognizes TLR5 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB

TLR5 Antibody
CSB-PA023604KA01HU-
EUR 335
  • Form: liquid
  • Buffer: Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Affinity purification
Description: A polyclonal antibody against TLR5. Recognizes TLR5 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:2000, IHC:1:50-1:200

TLR5 Antibody
CSB-PA023604KA01HU-100ul 100ul
EUR 389
  • Form: liquid
  • Buffer: Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Affinity purification
Description: A polyclonal antibody against TLR5. Recognizes TLR5 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:2000, IHC:1:50-1:200

TLR5 Antibody
1-CSB-PA023604LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TLR5. Recognizes TLR5 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:500-1:5000, IHC:1:20-1:200, IF:1:50-1:200

Polyclonal TLR5 antibody - N-terminal region
APR00592G 0.05mg
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human TLR5 - N-terminal region. This antibody is tested and proven to work in the following applications:

TLR5 (Phospho-Tyr798) Polyclonal Conjugated Antibody
C12648 100ul
EUR 397

TLR5 (Phospho-Ser805) Polyclonal Conjugated Antibody
C12997 100ul
EUR 397

TLR5 Conjugated Antibody
C49443 100ul
EUR 397

TLR5 Conjugated Antibody
C36165 100ul
EUR 397

anti- TLR5 antibody
FNab08728 100µg
EUR 548.75
  • Immunogen: toll-like receptor 5
  • Uniprot ID: O60602
  • Gene ID: 7100
  • Research Area: Immunology, Signal Transduction, Developmental biology
Description: Antibody raised against TLR5

TLR5 (pY798) Antibody
abx219007-100ug 100 ug
EUR 439
  • Shipped within 5-10 working days.

Anti-TLR5 Antibody
PB9451 100ug/vial
EUR 334

Anti-TLR5 antibody
PAab08728 100 ug
EUR 386

Anti-TLR5 Antibody
STJ503279 100 µg
EUR 476

Anti-TLR5 antibody
STJ119394 100 µl
EUR 277

Anti-TLR5 antibody
STJ190142 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to TLR5

TLR5(Toll-like receptor 5) Polyclonal Antibody
3555-100
EUR 370

Rabbit Anti-TLR5 monoclonal antibody, clone KN21-99
DCABH-5203 100 ul
EUR 777

TLR5 siRNA
20-abx936897
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

TLR5 siRNA
20-abx936898
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

anti-TLR5
YF-PA24857 50 ul
EUR 334
Description: Mouse polyclonal to TLR5

Phospho-TLR5 (Tyr798) Antibody
AF8327 200ul
EUR 376
Description: TLR5 (Phospho-Tyr798) Antibody detects endogenous levels of TLR5 only when phosphorylated at Tyr798.

Phospho-TLR5 (Ser805) Antibody
AF7134 200ul
EUR 376
Description: Phospho-TLR5 (Ser805) Antibody detects endogenous levels of TLR5 only when phosphorylated at Ser805.

TLR5 (Phospho- Tyr798) Antibody
ABF8327 100 ug
EUR 438

TLR5 recombinant monoclonal antibody
A5022 100ul X 3
EUR 595
  • Comparisons between Mnoclonal, Polyclonal and Recombinant antibodies and their benefits: Regular monoclonal antibodies have higher purity, better specificity and less lot-to-lot variations than polyclonal antibodies. Recombinant antibodies, however,
  • Show more
Description: A recombinant monoclonal antibody from rabbit against human TLR5 for WB,ELISA

TLR5 (Phospho-Tyr798) Antibody
12648-100ul 100ul
EUR 252

TLR5 (Phospho-Tyr798) Antibody
12648-50ul 50ul
EUR 187

TLR5 (Phospho-Ser805) Antibody
12997-100ul 100ul
EUR 252

TLR5 (Phospho-Ser805) Antibody
12997-50ul 50ul
EUR 187

TLR5 Antibody, HRP conjugated
1-CSB-PA023604LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TLR5. Recognizes TLR5 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

TLR5 Antibody, FITC conjugated
1-CSB-PA023604LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TLR5. Recognizes TLR5 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

TLR5 Antibody, Biotin conjugated
1-CSB-PA023604LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TLR5. Recognizes TLR5 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Anti-TLR5 Antibody (Biotin)
STJ503301 100 µg
EUR 586

Anti-TLR5 Antibody (FITC)
STJ503302 100 µg
EUR 586

Toll Like Receptor 5 (TLR5) Polyclonal Antibody (Human)
4-PAB990Hu01
  • EUR 239.00
  • EUR 2391.00
  • EUR 598.00
  • EUR 299.00
  • EUR 211.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TLR5 (Asn46~Ala205)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Toll Like Receptor 5 (TLR5)

Toll Like Receptor 5 (TLR5) Polyclonal Antibody (Human)
4-PAB990Hu02
  • EUR 239.00
  • EUR 2391.00
  • EUR 598.00
  • EUR 299.00
  • EUR 211.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TLR5 (Tyr693~Ser858)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Toll Like Receptor 5 (TLR5)

Toll Like Receptor 5 (TLR5) Polyclonal Antibody (Human)
4-PAB990Hu03
  • EUR 239.00
  • EUR 2391.00
  • EUR 598.00
  • EUR 299.00
  • EUR 211.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TLR5 (Leu303~Leu514)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Toll Like Receptor 5 (TLR5)

Toll Like Receptor 5 (TLR5) Polyclonal Antibody (Mouse)
4-PAB990Mu01
  • EUR 243.00
  • EUR 2457.00
  • EUR 613.00
  • EUR 305.00
  • EUR 212.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TLR5 (Lys327~Glu646)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Toll Like Receptor 5 (TLR5)

Toll Like Receptor 5 (TLR5) Polyclonal Antibody (Rat)
4-PAB990Ra01
  • EUR 251.00
  • EUR 2576.00
  • EUR 640.00
  • EUR 316.00
  • EUR 215.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TLR5 (Asp325~Glu644)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Toll Like Receptor 5 (TLR5)

TLR5 Blocking Peptide
AF7634-BP 1mg
EUR 195

TLR5 cloning plasmid
CSB-CL023604HU-10ug 10ug
EUR 831
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2577
  • Sequence: ATGGGAGACCACCTGGACCTTCTCCTAGGAGTGGTGCTCATGGCCGGTCCTGTGTTTGGAATTCCTTCCTGCTCCTTTGATGGCCGAATAGCCTTTTATCGTTTCTGCAACCTCACCCAGGTCCCCCAGGTCCTCAACACCACTGAGAGGCTCCTGCTGAGCTTCAACTATATCA
  • Show more
Description: A cloning plasmid for the TLR5 gene.

TLR5 Blocking Peptide
33R-10801 50 ug
EUR 191
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of TLR5 antibody, catalog no. 70R-11906

TLR5 Blocking Peptide
3555RBP-50
EUR 153

TLR5 Blocking Peptide
33R-7642 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of TLR5 antibody, catalog no. 70R-5979

TLR5 Rabbit Polyclonal Antibody

Back To Top