TLR5 Rabbit Polyclonal Antibody
To Order: garrett@bioworldantibodies.com
TLR5 Polyclonal Antibody |
ABP60699-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from part region of human TLR5 protein at amino acid sequence of 730-810
- Applications tips:
|
Description: A polyclonal antibody for detection of TLR5 from Human, Mouse. This TLR5 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human TLR5 protein at amino acid sequence of 730-810 |
TLR5 Polyclonal Antibody |
ABP60699-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human TLR5 protein at amino acid sequence of 730-810
- Applications tips:
|
Description: A polyclonal antibody for detection of TLR5 from Human, Mouse. This TLR5 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human TLR5 protein at amino acid sequence of 730-810 |
TLR5 Polyclonal Antibody |
ES8984-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against TLR5 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA |
TLR5 Polyclonal Antibody |
ES8984-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against TLR5 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA |
Human Toll Like Receptor 5 (TLR5) ELISA Kit |
DLR-TLR5-Hu-48T |
DL Develop |
48T |
EUR 498 |
- Should the Human Toll Like Receptor 5 (TLR5) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Toll Like Receptor 5 (TLR5) in samples from tissue homogenates, cell lysates, cell culture supernates or other biological fluids. |
Human Toll Like Receptor 5 (TLR5) ELISA Kit |
DLR-TLR5-Hu-96T |
DL Develop |
96T |
EUR 647 |
- Should the Human Toll Like Receptor 5 (TLR5) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Toll Like Receptor 5 (TLR5) in samples from tissue homogenates, cell lysates, cell culture supernates or other biological fluids. |
Human Toll Like Receptor 5 (TLR5) ELISA Kit |
RDR-TLR5-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 522 |
Human Toll Like Receptor 5 (TLR5) ELISA Kit |
RDR-TLR5-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 724 |
Human Toll Like Receptor 5 (TLR5) ELISA Kit |
RD-TLR5-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 500 |
Human Toll Like Receptor 5 (TLR5) ELISA Kit |
RD-TLR5-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 692 |
TLR5 Rabbit pAb |
A1721-100ul |
Abclonal |
100 ul |
EUR 308 |
TLR5 Rabbit pAb |
A1721-200ul |
Abclonal |
200 ul |
EUR 459 |
TLR5 Rabbit pAb |
A1721-20ul |
Abclonal |
20 ul |
EUR 183 |
TLR5 Rabbit pAb |
A1721-50ul |
Abclonal |
50 ul |
EUR 223 |
Polyclonal TLR5 Antibody (Internal) |
APR02281G |
Leading Biology |
0.05mg |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human TLR5 (Internal). This antibody is tested and proven to work in the following applications: |
Anti-TLR5 Rabbit Monoclonal Antibody |
M00462 |
BosterBio |
100ug/vial |
EUR 397 |
Description: Rabbit Monoclonal TLR5 Antibody. Validated in WB and tested in Human, Mouse, Rat. |
Polyclonal TLR5 Antibody (C-Terminus) |
APR02388G |
Leading Biology |
0.05mg |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human TLR5 (C-Terminus). This antibody is tested and proven to work in the following applications: |
Polyclonal TLR5 Antibody (aa300-350) |
APR02821G |
Leading Biology |
0.05mg |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human TLR5 (aa300-350). This antibody is tested and proven to work in the following applications: |
TLR5 Antibody |
24365-100ul |
SAB |
100ul |
EUR 390 |
TLR5 Antibody |
24366-100ul |
SAB |
100ul |
EUR 390 |
TLR5 antibody |
20R-1640 |
Fitzgerald |
100 ug |
EUR 673 |
Description: Rabbit polyclonal TLR5 antibody |
TLR5 antibody |
70R-11906 |
Fitzgerald |
100 ug |
EUR 403 |
Description: Rabbit polyclonal TLR5 antibody |
TLR5 antibody |
70R-20850 |
Fitzgerald |
50 ul |
EUR 435 |
Description: Rabbit polyclonal TLR5 antibody |
TLR5 Antibody |
35397-100ul |
SAB |
100ul |
EUR 390 |
TLR5 Antibody |
36165-100ul |
SAB |
100ul |
EUR 252 |
TLR5 antibody |
38286-100ul |
SAB |
100ul |
EUR 252 |
TLR5 Antibody |
49443-100ul |
SAB |
100ul |
EUR 333 |
TLR5 Antibody |
49443-50ul |
SAB |
50ul |
EUR 239 |
TLR5 Antibody |
DF6575 |
Affbiotech |
200ul |
EUR 304 |
Description: TLR5 Antibody detects endogenous levels of total TLR5. |
TLR5 Antibody |
1-CSB-PA296982 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against TLR5. Recognizes TLR5 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:5000, IHC:1:50-1:200 |
TLR5 Antibody |
1-CSB-PA218621 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against TLR5. Recognizes TLR5 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:5000, IHC:1:50-1:200 |
TLR5 antibody |
70R-5979 |
Fitzgerald |
50 ug |
EUR 467 |
Description: Rabbit polyclonal TLR5 antibody raised against the N terminal of TLR5 |
TLR5 Antibody |
1-CSB-PA023604GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
|
Description: A polyclonal antibody against TLR5. Recognizes TLR5 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB |
TLR5 Antibody |
CSB-PA023604KA01HU- |
Cusabio |
|
EUR 335 |
- Form: liquid
- Buffer: Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Affinity purification
|
Description: A polyclonal antibody against TLR5. Recognizes TLR5 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:2000, IHC:1:50-1:200 |
TLR5 Antibody |
CSB-PA023604KA01HU-100ul |
Cusabio |
100ul |
EUR 389 |
- Form: liquid
- Buffer: Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Affinity purification
|
Description: A polyclonal antibody against TLR5. Recognizes TLR5 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:2000, IHC:1:50-1:200 |
TLR5 Antibody |
1-CSB-PA023604LA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against TLR5. Recognizes TLR5 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:500-1:5000, IHC:1:20-1:200, IF:1:50-1:200 |
TLR5 Antibody |
AF7634 |
Affbiotech |
200ul |
EUR 376 |
Description: TLR5 Antibody detects endogenous levels of TLR5. |
Polyclonal TLR5 antibody - N-terminal region |
APR00592G |
Leading Biology |
0.05mg |
EUR 528 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human TLR5 - N-terminal region. This antibody is tested and proven to work in the following applications: |
TLR5 (Phospho-Tyr798) Polyclonal Conjugated Antibody |
C12648 |
SAB |
100ul |
EUR 397 |
TLR5 (Phospho-Ser805) Polyclonal Conjugated Antibody |
C12997 |
SAB |
100ul |
EUR 397 |
TLR5 (pY798) Antibody |
abx219007-100ug |
Abbexa |
100 ug |
EUR 439 |
- Shipped within 5-10 working days.
|
TLR5 Conjugated Antibody |
C49443 |
SAB |
100ul |
EUR 397 |
TLR5 Conjugated Antibody |
C36165 |
SAB |
100ul |
EUR 397 |
anti- TLR5 antibody |
FNab08728 |
FN Test |
100µg |
EUR 548.75 |
- Immunogen: toll-like receptor 5
- Uniprot ID: O60602
- Gene ID: 7100
- Research Area: Immunology, Signal Transduction, Developmental biology
|
Description: Antibody raised against TLR5 |
Anti-TLR5 Antibody |
PB9451 |
BosterBio |
100ug/vial |
EUR 334 |
Anti-TLR5 antibody |
STJ190142 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to TLR5 |
TLR5(Toll-like receptor 5) Polyclonal Antibody |
3555-100 |
Biovision |
|
EUR 370 |
TLR5 siRNA |
20-abx936897 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
TLR5 siRNA |
20-abx936898 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
anti-TLR5 |
YF-PA24857 |
Abfrontier |
50 ul |
EUR 334 |
Description: Mouse polyclonal to TLR5 |
TLR5 (Phospho-Ser805) Antibody |
12997-100ul |
SAB |
100ul |
EUR 252 |
TLR5 (Phospho-Ser805) Antibody |
12997-50ul |
SAB |
50ul |
EUR 187 |
TLR5 (Phospho-Tyr798) Antibody |
12648-100ul |
SAB |
100ul |
EUR 252 |
TLR5 (Phospho-Tyr798) Antibody |
12648-50ul |
SAB |
50ul |
EUR 187 |
Phospho-TLR5 (Ser805) Antibody |
AF7134 |
Affbiotech |
200ul |
EUR 376 |
Description: Phospho-TLR5 (Ser805) Antibody detects endogenous levels of TLR5 only when phosphorylated at Ser805. |
TLR5 Antibody, HRP conjugated |
1-CSB-PA023604LB01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against TLR5. Recognizes TLR5 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
TLR5 Antibody, FITC conjugated |
1-CSB-PA023604LC01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against TLR5. Recognizes TLR5 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
TLR5 Antibody, Biotin conjugated |
1-CSB-PA023604LD01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against TLR5. Recognizes TLR5 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
Phospho-TLR5 (Tyr798) Antibody |
AF8327 |
Affbiotech |
200ul |
EUR 376 |
Description: TLR5 (Phospho-Tyr798) Antibody detects endogenous levels of TLR5 only when phosphorylated at Tyr798. |
TLR5 recombinant monoclonal antibody |
A5022 |
Bimake |
100ul X 3 |
EUR 595 |
- Comparisons between Mnoclonal, Polyclonal and Recombinant antibodies and their benefits: Regular monoclonal antibodies have higher purity, better specificity and less lot-to-lot variations than polyclonal antibodies. Recombinant antibodies, however,
- Show more
|
Description: A recombinant monoclonal antibody from rabbit against human TLR5 for WB,ELISA |
Toll Like Receptor 5 (TLR5) Polyclonal Antibody (Human) |
4-PAB990Hu01 |
Cloud-Clone |
-
EUR 239.00
-
EUR 2391.00
-
EUR 598.00
-
EUR 299.00
-
EUR 211.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: TLR5 (Asn46~Ala205)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Toll Like Receptor 5 (TLR5) |
Toll Like Receptor 5 (TLR5) Polyclonal Antibody (Human) |
4-PAB990Hu02 |
Cloud-Clone |
-
EUR 239.00
-
EUR 2391.00
-
EUR 598.00
-
EUR 299.00
-
EUR 211.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: TLR5 (Tyr693~Ser858)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Toll Like Receptor 5 (TLR5) |
Toll Like Receptor 5 (TLR5) Polyclonal Antibody (Human) |
4-PAB990Hu03 |
Cloud-Clone |
-
EUR 239.00
-
EUR 2391.00
-
EUR 598.00
-
EUR 299.00
-
EUR 211.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: TLR5 (Leu303~Leu514)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Toll Like Receptor 5 (TLR5) |
Toll Like Receptor 5 (TLR5) Polyclonal Antibody (Mouse) |
4-PAB990Mu01 |
Cloud-Clone |
-
EUR 243.00
-
EUR 2457.00
-
EUR 613.00
-
EUR 305.00
-
EUR 212.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: TLR5 (Lys327~Glu646)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Toll Like Receptor 5 (TLR5) |
Toll Like Receptor 5 (TLR5) Polyclonal Antibody (Rat) |
4-PAB990Ra01 |
Cloud-Clone |
-
EUR 251.00
-
EUR 2576.00
-
EUR 640.00
-
EUR 316.00
-
EUR 215.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: TLR5 (Asp325~Glu644)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Toll Like Receptor 5 (TLR5) |
TLR5 Blocking Peptide |
33R-10801 |
Fitzgerald |
50 ug |
EUR 191 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of TLR5 antibody, catalog no. 70R-11906 |
TLR5 Blocking Peptide |
3555RBP-50 |
Biovision |
|
EUR 153 |
TLR5 Blocking Peptide |
33R-7642 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of TLR5 antibody, catalog no. 70R-5979 |
TLR5 Blocking Peptide |
DF6575-BP |
Affbiotech |
1mg |
EUR 195 |
TLR5 cloning plasmid |
CSB-CL023604HU-10ug |
Cusabio |
10ug |
EUR 831 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 2577
- Sequence: ATGGGAGACCACCTGGACCTTCTCCTAGGAGTGGTGCTCATGGCCGGTCCTGTGTTTGGAATTCCTTCCTGCTCCTTTGATGGCCGAATAGCCTTTTATCGTTTCTGCAACCTCACCCAGGTCCCCCAGGTCCTCAACACCACTGAGAGGCTCCTGCTGAGCTTCAACTATATCA
- Show more
|
Description: A cloning plasmid for the TLR5 gene. |
TLR5 Rabbit Polyclonal Antibody