Tmem72 Rabbit Polyclonal Antibody
To Order: garrett@bioworldantibodies.com
Tmem72 Polyclonal Antibody |
ABP60711-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Synthesized peptide derived from part region of human Tmem72 protein
- Applications tips:
|
Description: A polyclonal antibody for detection of Tmem72 from Human, Mouse, Rat. This Tmem72 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human Tmem72 protein |
Tmem72 Polyclonal Antibody |
ABP60711-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from part region of human Tmem72 protein
- Applications tips:
|
Description: A polyclonal antibody for detection of Tmem72 from Human, Mouse, Rat. This Tmem72 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human Tmem72 protein |
Tmem72 Polyclonal Antibody |
ABP60711-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human Tmem72 protein
- Applications tips:
|
Description: A polyclonal antibody for detection of Tmem72 from Human, Mouse, Rat. This Tmem72 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human Tmem72 protein |
Anti-Tmem72 antibody |
STJ99663 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Rabbit polyclonal to Tmem72. |
TMEM72 siRNA |
20-abx937436 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
TMEM72 siRNA |
20-abx937437 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
TMEM72 cloning plasmid |
CSB-CL023876HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 828
- Sequence: ATGCAGCTCCAGGTGTTCTGGACTGGGCTGGAATACACCTGCCGGCTCCTGGGCATCACCACTGCTGCAGTGTTGATCGGCGTGGGCACTGAGACCTTCCTCCAGGGCCAGTTCAAAAGCCTGGCTTTCTATCTGCTGTTTACAGGAGCCGCTGTCTCCATATGTGAAGGGGCCTA
- Show more
|
Description: A cloning plasmid for the TMEM72 gene. |
Mouse TMEM72 shRNA Plasmid |
20-abx983315 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Human TMEM72 shRNA Plasmid |
20-abx968447 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
TMEM72 Recombinant Protein (Human) |
RP044290 |
ABM |
100 ug |
Ask for price |
TMEM72 Recombinant Protein (Rat) |
RP233861 |
ABM |
100 ug |
Ask for price |
TMEM72 Recombinant Protein (Mouse) |
RP179885 |
ABM |
100 ug |
Ask for price |
Tmem72 ORF Vector (Mouse) (pORF) |
ORF059963 |
ABM |
1.0 ug DNA |
EUR 506 |
Tmem72 ORF Vector (Rat) (pORF) |
ORF077955 |
ABM |
1.0 ug DNA |
EUR 506 |
TMEM72 ORF Vector (Human) (pORF) |
ORF014764 |
ABM |
1.0 ug DNA |
EUR 354 |
TMEM72 sgRNA CRISPR Lentivector set (Human) |
K2393101 |
ABM |
3 x 1.0 ug |
EUR 339 |
Tmem72 sgRNA CRISPR Lentivector set (Mouse) |
K3780401 |
ABM |
3 x 1.0 ug |
EUR 339 |
Tmem72 sgRNA CRISPR Lentivector set (Rat) |
K6630001 |
ABM |
3 x 1.0 ug |
EUR 339 |
TMEM72-AS1 ORF Vector (Human) (pORF) |
ORF034069 |
ABM |
1.0 ug DNA |
Ask for price |
Human Transmembrane protein 72, TMEM72 ELISA KIT |
ELI-17128h |
Lifescience Market |
96 Tests |
EUR 824 |
Mouse Transmembrane protein 72, Tmem72 ELISA KIT |
ELI-36435m |
Lifescience Market |
96 Tests |
EUR 865 |
TMEM72 sgRNA CRISPR Lentivector (Human) (Target 1) |
K2393102 |
ABM |
1.0 ug DNA |
EUR 154 |
TMEM72 sgRNA CRISPR Lentivector (Human) (Target 2) |
K2393103 |
ABM |
1.0 ug DNA |
EUR 154 |
TMEM72 sgRNA CRISPR Lentivector (Human) (Target 3) |
K2393104 |
ABM |
1.0 ug DNA |
EUR 154 |
Tmem72 sgRNA CRISPR Lentivector (Mouse) (Target 1) |
K3780402 |
ABM |
1.0 ug DNA |
EUR 154 |
Tmem72 sgRNA CRISPR Lentivector (Mouse) (Target 2) |
K3780403 |
ABM |
1.0 ug DNA |
EUR 154 |
Tmem72 sgRNA CRISPR Lentivector (Mouse) (Target 3) |
K3780404 |
ABM |
1.0 ug DNA |
EUR 154 |
Tmem72 sgRNA CRISPR Lentivector (Rat) (Target 1) |
K6630002 |
ABM |
1.0 ug DNA |
EUR 154 |
Tmem72 sgRNA CRISPR Lentivector (Rat) (Target 2) |
K6630003 |
ABM |
1.0 ug DNA |
EUR 154 |
Tmem72 sgRNA CRISPR Lentivector (Rat) (Target 3) |
K6630004 |
ABM |
1.0 ug DNA |
EUR 154 |
TMEM72 Protein Vector (Human) (pPB-C-His) |
PV059053 |
ABM |
500 ng |
EUR 481 |
TMEM72 Protein Vector (Human) (pPB-N-His) |
PV059054 |
ABM |
500 ng |
EUR 481 |
TMEM72 Protein Vector (Human) (pPM-C-HA) |
PV059055 |
ABM |
500 ng |
EUR 481 |
TMEM72 Protein Vector (Human) (pPM-C-His) |
PV059056 |
ABM |
500 ng |
EUR 481 |
TMEM72 Protein Vector (Rat) (pPB-C-His) |
PV311818 |
ABM |
500 ng |
EUR 603 |
TMEM72 Protein Vector (Rat) (pPB-N-His) |
PV311819 |
ABM |
500 ng |
EUR 603 |
TMEM72 Protein Vector (Rat) (pPM-C-HA) |
PV311820 |
ABM |
500 ng |
EUR 603 |
TMEM72 Protein Vector (Rat) (pPM-C-His) |
PV311821 |
ABM |
500 ng |
EUR 603 |
TMEM72 Protein Vector (Mouse) (pPB-C-His) |
PV239850 |
ABM |
500 ng |
EUR 603 |
TMEM72 Protein Vector (Mouse) (pPB-N-His) |
PV239851 |
ABM |
500 ng |
EUR 603 |
TMEM72 Protein Vector (Mouse) (pPM-C-HA) |
PV239852 |
ABM |
500 ng |
EUR 603 |
Tmem72 Rabbit Polyclonal Antibody