Tmem72 Rabbit Polyclonal Antibody

Tmem72 Rabbit Polyclonal Antibody

To Order: garrett@bioworldantibodies.com

Tmem72 Polyclonal Antibody

ABP60711-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human Tmem72 protein
  • Applications tips:
Description: A polyclonal antibody for detection of Tmem72 from Human, Mouse, Rat. This Tmem72 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human Tmem72 protein

Tmem72 Polyclonal Antibody

ABP60711-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human Tmem72 protein
  • Applications tips:
Description: A polyclonal antibody for detection of Tmem72 from Human, Mouse, Rat. This Tmem72 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human Tmem72 protein

Tmem72 Polyclonal Antibody

ABP60711-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human Tmem72 protein
  • Applications tips:
Description: A polyclonal antibody for detection of Tmem72 from Human, Mouse, Rat. This Tmem72 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human Tmem72 protein

Anti-Tmem72 antibody

STJ99663 200 µl
EUR 197
Description: Rabbit polyclonal to Tmem72.

TMEM72 siRNA

20-abx937436
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

TMEM72 siRNA

20-abx937437
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

TMEM72 cloning plasmid

CSB-CL023876HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 828
  • Sequence: ATGCAGCTCCAGGTGTTCTGGACTGGGCTGGAATACACCTGCCGGCTCCTGGGCATCACCACTGCTGCAGTGTTGATCGGCGTGGGCACTGAGACCTTCCTCCAGGGCCAGTTCAAAAGCCTGGCTTTCTATCTGCTGTTTACAGGAGCCGCTGTCTCCATATGTGAAGGGGCCTA
  • Show more
Description: A cloning plasmid for the TMEM72 gene.

Mouse TMEM72 shRNA Plasmid

20-abx983315
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human TMEM72 shRNA Plasmid

20-abx968447
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

TMEM72 Recombinant Protein (Human)

RP044290 100 ug Ask for price

TMEM72 Recombinant Protein (Rat)

RP233861 100 ug Ask for price

TMEM72 Recombinant Protein (Mouse)

RP179885 100 ug Ask for price

Tmem72 ORF Vector (Mouse) (pORF)

ORF059963 1.0 ug DNA
EUR 506

Tmem72 ORF Vector (Rat) (pORF)

ORF077955 1.0 ug DNA
EUR 506

TMEM72 ORF Vector (Human) (pORF)

ORF014764 1.0 ug DNA
EUR 354

TMEM72 sgRNA CRISPR Lentivector set (Human)

K2393101 3 x 1.0 ug
EUR 339

Tmem72 sgRNA CRISPR Lentivector set (Mouse)

K3780401 3 x 1.0 ug
EUR 339

Tmem72 sgRNA CRISPR Lentivector set (Rat)

K6630001 3 x 1.0 ug
EUR 339

TMEM72-AS1 ORF Vector (Human) (pORF)

ORF034069 1.0 ug DNA Ask for price

Human Transmembrane protein 72, TMEM72 ELISA KIT

ELI-17128h 96 Tests
EUR 824

Mouse Transmembrane protein 72, Tmem72 ELISA KIT

ELI-36435m 96 Tests
EUR 865

TMEM72 sgRNA CRISPR Lentivector (Human) (Target 1)

K2393102 1.0 ug DNA
EUR 154

TMEM72 sgRNA CRISPR Lentivector (Human) (Target 2)

K2393103 1.0 ug DNA
EUR 154

TMEM72 sgRNA CRISPR Lentivector (Human) (Target 3)

K2393104 1.0 ug DNA
EUR 154

Tmem72 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3780402 1.0 ug DNA
EUR 154

Tmem72 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3780403 1.0 ug DNA
EUR 154

Tmem72 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3780404 1.0 ug DNA
EUR 154

Tmem72 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6630002 1.0 ug DNA
EUR 154

Tmem72 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6630003 1.0 ug DNA
EUR 154

Tmem72 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6630004 1.0 ug DNA
EUR 154

TMEM72 Protein Vector (Human) (pPB-C-His)

PV059053 500 ng
EUR 481

TMEM72 Protein Vector (Human) (pPB-N-His)

PV059054 500 ng
EUR 481

TMEM72 Protein Vector (Human) (pPM-C-HA)

PV059055 500 ng
EUR 481

TMEM72 Protein Vector (Human) (pPM-C-His)

PV059056 500 ng
EUR 481

TMEM72 Protein Vector (Rat) (pPB-C-His)

PV311818 500 ng
EUR 603

TMEM72 Protein Vector (Rat) (pPB-N-His)

PV311819 500 ng
EUR 603

TMEM72 Protein Vector (Rat) (pPM-C-HA)

PV311820 500 ng
EUR 603

TMEM72 Protein Vector (Rat) (pPM-C-His)

PV311821 500 ng
EUR 603

TMEM72 Protein Vector (Mouse) (pPB-C-His)

PV239850 500 ng
EUR 603

TMEM72 Protein Vector (Mouse) (pPB-N-His)

PV239851 500 ng
EUR 603

TMEM72 Protein Vector (Mouse) (pPM-C-HA)

PV239852 500 ng
EUR 603

Tmem72 Rabbit Polyclonal Antibody

Back To Top