USF1 Rabbit Polyclonal Antibody
To Order: garrett@bioworldantibodies.com
USF1 Polyclonal Antibody |
ABP60862-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human USF1 protein at amino acid sequence of 90-170
- Applications tips:
|
Description: A polyclonal antibody for detection of USF1 from Human, Mouse. This USF1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human USF1 protein at amino acid sequence of 90-170 |
USF1 Polyclonal Antibody |
A54724 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: Ask the seller for details |
USF1 Rabbit pAb |
A13560-100ul |
Abclonal |
100 ul |
EUR 308 |
USF1 Rabbit pAb |
A13560-200ul |
Abclonal |
200 ul |
EUR 459 |
USF1 Rabbit pAb |
A13560-20ul |
Abclonal |
20 ul |
EUR 183 |
USF1 Rabbit pAb |
A13560-50ul |
Abclonal |
50 ul |
EUR 223 |
USF1 Antibody |
42816-100ul |
SAB |
100ul |
EUR 252 |
USF1 Antibody |
32414-100ul |
SAB |
100ul |
EUR 252 |
USF1 Antibody |
DF6592 |
Affbiotech |
200ul |
EUR 304 |
Description: USF1 Antibody detects endogenous levels of total USF1. |
USF1 Antibody |
1-CSB-PA938350 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against USF1. Recognizes USF1 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:25-1:100 |
USF1 Antibody |
1-CSB-PA980290 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against USF1. Recognizes USF1 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:25-1:100 |
USF1 Antibody |
1-CSB-PA025681HA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against USF1. Recognizes USF1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200 |
USF1 Antibody |
CSB-PA025681KA01HU- |
Cusabio |
|
EUR 335 |
- Form: liquid
- Buffer: Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Affinity purification
|
Description: A polyclonal antibody against USF1. Recognizes USF1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:2000, IHC:1:50-1:200 |
USF1 Antibody |
CSB-PA025681KA01HU-100ul |
Cusabio |
100ul |
EUR 389 |
- Form: liquid
- Buffer: Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Affinity purification
|
Description: A polyclonal antibody against USF1. Recognizes USF1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:2000, IHC:1:50-1:200 |
USF1 Polyclonal Antibody, Biotin Conjugated |
A54721 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: reagents widely cited |
USF1 Polyclonal Antibody, FITC Conjugated |
A54722 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: Ask the seller for details |
USF1 Polyclonal Antibody, HRP Conjugated |
A54723 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: The best epigenetics products |
USF1 (Phospho-Thr153) Polyclonal Conjugated Antibody |
C12651 |
SAB |
100ul |
EUR 397 |
USF1 Conjugated Antibody |
C32414 |
SAB |
100ul |
EUR 397 |
anti- USF1 antibody |
FNab09297 |
FN Test |
100µg |
EUR 585 |
- Recommended dilution: WB: 1:500 - 1:2000
- IHC: 1:50 - 1:200
- Immunogen: upstream transcription factor 1
- Uniprot ID: P22415
- Gene ID: 7391
- Research Area: Metabolism
|
Description: Antibody raised against USF1 |
USF1 (pT153) Antibody |
abx219267-100ug |
Abbexa |
100 ug |
EUR 439 |
- Shipped within 5-10 working days.
|
Anti-USF1 antibody |
STJ26051 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: This gene encodes a member of the basic helix-loop-helix leucine zipper family, and can function as a cellular transcription factor. The encoded protein can activate transcription through pyrimidine-rich initiator (Inr) elements and E-box motifs. This gene has been linked to familial combined hyperlipidemia (FCHL). Alternative splicing of this gene results in multiple transcript variants. A related pseudogene has been defined on chromosome 21. |
Anti-USF1 antibody |
STJ115521 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: This gene encodes a member of the basic helix-loop-helix leucine zipper family, and can function as a cellular transcription factor. The encoded protein can activate transcription through pyrimidine-rich initiator (Inr) elements and E-box motifs. This gene has been linked to familial combined hyperlipidemia (FCHL). Alternative splicing of this gene results in multiple transcript variants. A related pseudogene has been defined on chromosome 21. |
Anti-USF1 antibody |
STJ190144 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to USF1 |
USF1 siRNA |
20-abx939129 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
USF1 siRNA |
20-abx939130 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
anti-USF1 |
YF-PA15249 |
Abfrontier |
100 ug |
EUR 403 |
Description: Rabbit polyclonal to USF1 |
anti-USF1 |
YF-PA27396 |
Abfrontier |
50 ug |
EUR 363 |
Description: Mouse polyclonal to USF1 |
anti-USF1 |
YF-PA24948 |
Abfrontier |
50 ul |
EUR 334 |
Description: Mouse polyclonal to USF1 |
Phospho-USF1 (Thr153) Antibody |
AF8331 |
Affbiotech |
200ul |
EUR 376 |
Description: USF1 (Phospho-Thr153) Antibody detects endogenous levels of USF1 only when phosphorylated at Thr153. |
USF1 (Phospho-Thr153) Antibody |
12651-100ul |
SAB |
100ul |
EUR 252 |
USF1 (Phospho-Thr153) Antibody |
12651-50ul |
SAB |
50ul |
EUR 187 |
USF1 Antibody, HRP conjugated |
1-CSB-PA025681HB01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against USF1. Recognizes USF1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
USF1 Antibody, FITC conjugated |
1-CSB-PA025681HC01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against USF1. Recognizes USF1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
USF1 Antibody, Biotin conjugated |
1-CSB-PA025681HD01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against USF1. Recognizes USF1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
Rabbit Anti-Human upstream transcription factor 1 (USF1) (USF1- acetyl) IgG (aff pure) |
AB-23272-A |
Alpha Diagnostics |
100ug |
EUR 482 |
USF1 cloning plasmid |
CSB-CL025681HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 933
- Sequence: atgaaggggcagcagaaaacagctgaaacggaagaggggacagtgcagattcaggaaggtgcagtggctactggggaagacccaaccagtgtggctattgccagcatccagtcagctgccaccttccctgaccccaacgtcaagtacgtcttccgaactgagaatgggggccaggt
- Show more
|
Description: A cloning plasmid for the USF1 gene. |
USF1 Blocking Peptide |
DF6592-BP |
Affbiotech |
1mg |
EUR 195 |
Anti-USF1 (3F6) |
YF-MA16035 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to USF1 |
Anti-USF1 (2A7) |
YF-MA16036 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to USF1 |
Rabbit Upstream stimulatory factor 1, USF1 ELISA KIT |
ELI-16725Ra |
Lifescience Market |
96 Tests |
EUR 928 |
Human upstream transcription factor 1 (USF1) control (USF1- acetyl) peptide |
AB-23272-P |
Alpha Diagnostics |
100ug |
EUR 164 |
Monoclonal USF1 Antibody (Center), Clone: 1264CT170.274.14 |
APR10696G |
Leading Biology |
0.1ml |
EUR 484 |
Description: A Monoclonal antibody against Human USF1 (Center). The antibodies are raised in Mouse and are from clone 1264CT170.274.14. This antibody is applicable in WB, E |
Upstream Stimulatory Factor 1 (USF1) Antibody |
abx117152-100ug |
Abbexa |
100 ug |
EUR 467 |
- Shipped within 5-10 working days.
|
Upstream Stimulatory Factor 1 (USF1) Antibody |
20-abx110338 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Upstream Stimulatory Factor 1 (USF1) Antibody |
20-abx001455 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
Upstream Stimulatory Factor 1 (USF1) Antibody |
20-abx142299 |
Abbexa |
-
EUR 370.00
-
EUR 606.00
-
EUR 314.00
|
|
- Shipped within 5-10 working days.
|
Upstream Stimulatory Factor 1 (USF1) Antibody |
abx037743-100ug |
Abbexa |
100 ug |
EUR 391 |
- Shipped within 5-10 working days.
|
Upstream Stimulatory Factor 1 (USF1) Antibody |
abx026074-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
Upstream Stimulatory Factor 1 (USF1) Antibody |
abx026074-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
Upstream Stimulatory Factor 1 (USF1) Antibody |
abx239297-100ug |
Abbexa |
100 ug |
EUR 551 |
- Shipped within 5-12 working days.
|
Upstream stimulatory factor 1 (USF1) Antibody |
20-abx212705 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Upstream stimulatory factor 1 (USF1) Antibody |
20-abx212706 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Human USF1 shRNA Plasmid |
20-abx955057 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
USF1 protein (His tag) |
80R-3580 |
Fitzgerald |
50 ug |
EUR 424 |
Description: Purified recombinant USF1 protein (His tag) |
Mouse USF1 shRNA Plasmid |
20-abx973332 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
USF1 Recombinant Protein (Human) |
RP034054 |
ABM |
100 ug |
Ask for price |
USF1 Recombinant Protein (Rat) |
RP236000 |
ABM |
100 ug |
Ask for price |
USF1 Recombinant Protein (Mouse) |
RP183287 |
ABM |
100 ug |
Ask for price |
Monoclonal USF1 Antibody (monoclonal) (M01), Clone: 3F6 |
APR10697G |
Leading Biology |
0.1mg |
EUR 484 |
Description: A Monoclonal antibody against Human USF1 (monoclonal) (M01). The antibodies are raised in mouse and are from clone 3F6. This antibody is applicable in WB, E |
Monoclonal USF1 Antibody (monoclonal) (M02), Clone: 2A7 |
APR10698G |
Leading Biology |
0.1mg |
EUR 484 |
Description: A Monoclonal antibody against Human USF1 (monoclonal) (M02). The antibodies are raised in mouse and are from clone 2A7. This antibody is applicable in WB, E |
Phospho-USF1 (Thr153) Blocking Peptide |
AF8331-BP |
Affbiotech |
1mg |
EUR 195 |
Usf1 ORF Vector (Rat) (pORF) |
ORF078668 |
ABM |
1.0 ug DNA |
EUR 506 |
USF1 ORF Vector (Human) (pORF) |
ORF011352 |
ABM |
1.0 ug DNA |
EUR 95 |
Usf1 ORF Vector (Mouse) (pORF) |
ORF061097 |
ABM |
1.0 ug DNA |
EUR 506 |
USF1 ELISA Kit (Mouse) (OKEH03687) |
OKEH03687 |
Aviva Systems Biology |
96 Wells |
EUR 779 |
Description: Description of target: Transcription factor that binds to a symmetrical DNA sequence (E-boxes) (5'-CACGTG-3') that is found in a variety of viral and cellular promoters.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.19 ng/mL |
Upstream Stimulatory Factor 1 (USF1) Protein |
20-abx262723 |
Abbexa |
-
EUR 328.00
-
EUR 6397.00
-
EUR 230.00
|
|
- Shipped within 5-10 working days.
|
USF1 sgRNA CRISPR Lentivector set (Human) |
K2594401 |
ABM |
3 x 1.0 ug |
EUR 339 |
Usf1 sgRNA CRISPR Lentivector set (Mouse) |
K4640001 |
ABM |
3 x 1.0 ug |
EUR 339 |
Human Upstream stimulatory factor 1 (USF1) |
1-CSB-EP025681HU |
Cusabio |
-
EUR 380.00
-
EUR 214.00
-
EUR 1309.00
-
EUR 560.00
-
EUR 873.00
-
EUR 262.00
|
-
100ug
-
10ug
-
1MG
-
200ug
-
500ug
-
50ug
|
- MW: 37.3 kDa
- Buffer composition: Tris-based buffer with 50% glycerol.
|
Description: Recombinant Human Upstream stimulatory factor 1(USF1),partial expressed in E.coli |
Usf1 sgRNA CRISPR Lentivector set (Rat) |
K7068101 |
ABM |
3 x 1.0 ug |
EUR 339 |
USF1 sgRNA CRISPR Lentivector (Human) (Target 1) |
K2594402 |
ABM |
1.0 ug DNA |
EUR 154 |
USF1 sgRNA CRISPR Lentivector (Human) (Target 2) |
K2594403 |
ABM |
1.0 ug DNA |
EUR 154 |
USF1 sgRNA CRISPR Lentivector (Human) (Target 3) |
K2594404 |
ABM |
1.0 ug DNA |
EUR 154 |
Usf1 sgRNA CRISPR Lentivector (Mouse) (Target 1) |
K4640002 |
ABM |
1.0 ug DNA |
EUR 154 |
USF1 Rabbit Polyclonal Antibody