VHL Rabbit Polyclonal Antibody

VHL Rabbit Polyclonal Antibody

To Order: garrett@bioworldantibodies.com

VHL Polyclonal Antibody

ABP60891-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human VHL protein at amino acid sequence of 1-50
  • Applications tips:
Description: A polyclonal antibody for detection of VHL from Human. This VHL antibody is for IHC-P, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human VHL protein at amino acid sequence of 1-50

VHL Polyclonal Antibody

ABP60891-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human VHL protein at amino acid sequence of 1-50
  • Applications tips:
Description: A polyclonal antibody for detection of VHL from Human. This VHL antibody is for IHC-P, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human VHL protein at amino acid sequence of 1-50

VHL Polyclonal Antibody

ABP60891-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human VHL protein at amino acid sequence of 1-50
  • Applications tips:
Description: A polyclonal antibody for detection of VHL from Human. This VHL antibody is for IHC-P, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human VHL protein at amino acid sequence of 1-50

VHL Polyclonal Antibody

ABP56500-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from human VHL around the non-phosphorylation site of S68
  • Applications tips:
Description: A polyclonal antibody for detection of VHL from Human, Mouse, Rat. This VHL antibody is for IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human VHL around the non-phosphorylation site of S68

VHL Polyclonal Antibody

ABP56500-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from human VHL around the non-phosphorylation site of S68
  • Applications tips:
Description: A polyclonal antibody for detection of VHL from Human, Mouse, Rat. This VHL antibody is for IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human VHL around the non-phosphorylation site of S68

VHL Polyclonal Antibody

ABP56500-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from human VHL around the non-phosphorylation site of S68
  • Applications tips:
Description: A polyclonal antibody for detection of VHL from Human, Mouse, Rat. This VHL antibody is for IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human VHL around the non-phosphorylation site of S68

VHL Polyclonal Antibody

ES7499-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against VHL from Human/Mouse/Rat. This antibody is tested and validated for IHC, WB, ELISA

VHL Polyclonal Antibody

ES7499-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against VHL from Human/Mouse/Rat. This antibody is tested and validated for IHC, WB, ELISA

VHL Polyclonal Antibody

ES8746-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against VHL from Human. This antibody is tested and validated for IHC, WB, ELISA

VHL Polyclonal Antibody

ES8746-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against VHL from Human. This antibody is tested and validated for IHC, WB, ELISA

VHL Rabbit pAb

A11240-100ul 100 ul
EUR 308

VHL Rabbit pAb

A11240-200ul 200 ul
EUR 459

VHL Rabbit pAb

A11240-20ul 20 ul
EUR 183

VHL Rabbit pAb

A11240-50ul 50 ul
EUR 223

VHL Rabbit pAb

A16287-100ul 100 ul
EUR 308

VHL Rabbit pAb

A16287-200ul 200 ul
EUR 459

VHL Rabbit pAb

A16287-20ul 20 ul
EUR 183

VHL Rabbit pAb

A16287-50ul 50 ul
EUR 223

VHL Rabbit pAb

A0377-100ul 100 ul
EUR 308

VHL Rabbit pAb

A0377-200ul 200 ul
EUR 459

VHL Rabbit pAb

A0377-20ul 20 ul
EUR 183

VHL Rabbit pAb

A0377-50ul 50 ul
EUR 223

Human Von Hippel Lindau Tumor Suppressor (vHL) ELISA Kit

DLR-vHL-Hu-48T 48T
EUR 549
  • Should the Human Von Hippel Lindau Tumor Suppressor (vHL) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Von Hippel Lindau Tumor Suppressor (vHL) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Human Von Hippel Lindau Tumor Suppressor (vHL) ELISA Kit

DLR-vHL-Hu-96T 96T
EUR 718
  • Should the Human Von Hippel Lindau Tumor Suppressor (vHL) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Von Hippel Lindau Tumor Suppressor (vHL) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Rat Von Hippel Lindau Tumor Suppressor (vHL) ELISA Kit

DLR-vHL-Ra-48T 48T
EUR 549
  • Should the Rat Von Hippel Lindau Tumor Suppressor (vHL) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Von Hippel Lindau Tumor Suppressor (vHL) in samples from tissue homogenates or other biological fluids.

Rat Von Hippel Lindau Tumor Suppressor (vHL) ELISA Kit

DLR-vHL-Ra-96T 96T
EUR 718
  • Should the Rat Von Hippel Lindau Tumor Suppressor (vHL) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Von Hippel Lindau Tumor Suppressor (vHL) in samples from tissue homogenates or other biological fluids.

Human Von Hippel Lindau Tumor Suppressor (vHL) ELISA Kit

RDR-vHL-Hu-48Tests 48 Tests
EUR 583

Human Von Hippel Lindau Tumor Suppressor (vHL) ELISA Kit

RDR-vHL-Hu-96Tests 96 Tests
EUR 811

Rat Von Hippel Lindau Tumor Suppressor (vHL) ELISA Kit

RDR-vHL-Ra-48Tests 48 Tests
EUR 583

Rat Von Hippel Lindau Tumor Suppressor (vHL) ELISA Kit

RDR-vHL-Ra-96Tests 96 Tests
EUR 811

Human Von Hippel Lindau Tumor Suppressor (vHL) ELISA Kit

RD-vHL-Hu-48Tests 48 Tests
EUR 557

Human Von Hippel Lindau Tumor Suppressor (vHL) ELISA Kit

RD-vHL-Hu-96Tests 96 Tests
EUR 775

Rat Von Hippel Lindau Tumor Suppressor (vHL) ELISA Kit

RD-vHL-Ra-48Tests 48 Tests
EUR 557

Rat Von Hippel Lindau Tumor Suppressor (vHL) ELISA Kit

RD-vHL-Ra-96Tests 96 Tests
EUR 775

Polyclonal VHL Antibody (C-term)

APR10723G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human VHL (C-term). This antibody is tested and proven to work in the following applications:

Polyclonal Goat Anti-VHL Antibody

AMM05157G 0.1 mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human Goat Anti-VHL . This antibody is tested and proven to work in the following applications:

VHL (phospho Ser68) Polyclonal Antibody

ABP56499-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from human VHL around the phosphorylation site of S68
  • Applications tips:
Description: A polyclonal antibody for detection of VHL phospho Ser68) from Human, Mouse, Rat. This VHL phospho Ser68) antibody is for IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human VHL around the phosphorylation site of S68

VHL (phospho Ser68) Polyclonal Antibody

ABP56499-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from human VHL around the phosphorylation site of S68
  • Applications tips:
Description: A polyclonal antibody for detection of VHL phospho Ser68) from Human, Mouse, Rat. This VHL phospho Ser68) antibody is for IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human VHL around the phosphorylation site of S68

VHL (phospho Ser68) Polyclonal Antibody

ABP56499-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from human VHL around the phosphorylation site of S68
  • Applications tips:
Description: A polyclonal antibody for detection of VHL phospho Ser68) from Human, Mouse, Rat. This VHL phospho Ser68) antibody is for IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human VHL around the phosphorylation site of S68

VHL (phospho Ser68) Polyclonal Antibody

ES7498-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against VHL (phospho Ser68) from Human/Mouse/Rat. This antibody is tested and validated for IHC, WB, ELISA

VHL (phospho Ser68) Polyclonal Antibody

ES7498-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against VHL (phospho Ser68) from Human/Mouse/Rat. This antibody is tested and validated for IHC, WB, ELISA

VHL Antibody

32075-100ul 100ul
EUR 252

VHL antibody

10R-1029 100 ul
EUR 316
Description: Mouse monoclonal VHL antibody

VHL Antibody

  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against VHL. Recognizes VHL from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: IHC, ELISA;IHC:1/100-1/300.ELISA:1/40000

VHL Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against VHL. Recognizes VHL from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:500-1:2000, IHC:1:25-1:100

VHL Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against VHL. Recognizes VHL from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:10000, IHC:1:50-1:200

VHL Antibody

  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: PBS, pH 7.4, containing 0.02% sodium azide as Preservative and 50% Glycerol. The antibody was affinity-purified from rabbit serum by affinity-chromatography using specific immunogen.
Description: A polyclonal antibody against VHL. Recognizes VHL from Human. This antibody is Unconjugated. Tested in the following application: IHC, ELISA;IHC-p:1:50-300, ELISA:1:10000-20000

VHL Antibody

DF6104 200ul
EUR 304
Description: VHL Antibody detects endogenous levels of total VHL.

VHL Antibody

EUR 335
  • Form: liquid
  • Buffer: Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Affinity purification
Description: A polyclonal antibody against VHL. Recognizes VHL from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:2000, IHC:1:50-1:200

VHL Antibody

CSB-PA025852KA01HU-100ul 100ul
EUR 389
  • Form: liquid
  • Buffer: Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Affinity purification
Description: A polyclonal antibody against VHL. Recognizes VHL from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:2000, IHC:1:50-1:200

VHL antibody

70R-9757 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal VHL antibody

VHL antibody

70R-34605 100 ug
EUR 327
Description: Purified Rabbit polyclonal VHL antibody

VHL Antibody

AF6292 200ul
EUR 304
Description: VHL Antibody detects endogenous levels of total VHL.

VHL Antibody

ABF6292 100 ug
EUR 438

VHL Antibody

ABD6104 100 ug
EUR 438

VHL (Phospho-Ser68) Polyclonal Conjugated Antibody

C12654 100ul
EUR 397

Human VHL Antibody

32825-05111 150 ug
EUR 261

VHL (pS68) Antibody

abx219320-100ug 100 ug
EUR 439
  • Shipped within 5-10 working days.

VHL Conjugated Antibody

C32075 100ul
EUR 397

anti- VHL antibody

FNab09402 100µg
EUR 548.75
  • Recommended dilution: IF: 1:10-1:100
  • IHC: 1:20-1:200
  • Immunogen: von Hippel-Lindau tumor suppressor
  • Uniprot ID: P40337
  • Gene ID: 7428
  • Research Area: Cancer, Metabolism
Description: Antibody raised against VHL

anti- VHL antibody

FNab10175 100µg
EUR 505.25
  • Recommended dilution: IHC: 1:50-1:500
  • Immunogen: Histone-lysine N-methyltransferase EZH2
  • Uniprot ID: P40337
  • Gene ID: 7428
Description: Antibody raised against VHL

Anti-VHL antibody

PAab09402 100 ug
EUR 386

Anti-VHL antibody

STJ98809 200 µl
EUR 197
Description: Rabbit polyclonal to VHL.

Anti-VHL antibody

STJ26089 100 µl
EUR 277
Description: Von Hippel-Lindau syndrome (VHL) is a dominantly inherited familial cancer syndrome predisposing to a variety of malignant and benign tumors. A germline mutation of this gene is the basis of familial inheritance of VHL syndrome. The protein encoded by this gene is a component of the protein complex that includes elongin B, elongin C, and cullin-2, and possesses ubiquitin ligase E3 activity. This protein is involved in the ubiquitination and degradation of hypoxia-inducible-factor (HIF), which is a transcription factor that plays a central role in the regulation of gene expression by oxygen. RNA polymerase II subunit POLR2G/RPB7 is also reported to be a target of this protein. Alternatively spliced transcript variants encoding distinct isoforms have been observed.

Anti-VHL antibody

STJ113440 50 µl
EUR 277
Description: Von Hippel-Lindau syndrome (VHL) is a dominantly inherited familial cancer syndrome predisposing to a variety of malignant and benign tumors. A germline mutation of this gene is the basis of familial inheritance of VHL syndrome. The protein encoded by this gene is a component of the protein complex that includes elongin B, elongin C, and cullin-2, and possesses ubiquitin ligase E3 activity. This protein is involved in the ubiquitination and degradation of hypoxia-inducible-factor (HIF), which is a transcription factor that plays a central role in the regulation of gene expression by oxygen. RNA polymerase II subunit POLR2G/RPB7 is also reported to be a target of this protein. Alternatively spliced transcript variants encoding distinct isoforms have been observed.

Anti-VHL antibody

STJ113742 100 µl
EUR 277
Description: Von Hippel-Lindau syndrome (VHL) is a dominantly inherited familial cancer syndrome predisposing to a variety of malignant and benign tumors. A germline mutation of this gene is the basis of familial inheritance of VHL syndrome. The protein encoded by this gene is a component of the protein complex that includes elongin B, elongin C, and cullin-2, and possesses ubiquitin ligase E3 activity. This protein is involved in the ubiquitination and degradation of hypoxia-inducible-factor (HIF), which is a transcription factor that plays a central role in the regulation of gene expression by oxygen. RNA polymerase II subunit POLR2G/RPB7 is also reported to be a target of this protein. Alternatively spliced transcript variants encoding distinct isoforms have been observed.

Anti-VHL antibody

STJ118733 100 µl
EUR 277

Anti-VHL antibody

STJ96241 200 µl
EUR 197
Description: Rabbit polyclonal to VHL.

Anti-VHL antibody

STJ70964 100 µg
EUR 359

Anti-VHL Antibody

STJ502735 100 µg
EUR 476


ELA-E1894r 96 Tests
EUR 886

Vhl/ Rat Vhl ELISA Kit

ELI-06080r 96 Tests
EUR 886


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

VHL (Phospho-Ser68) Antibody

12654-100ul 100ul
EUR 252

VHL (Phospho-Ser68) Antibody

12654-50ul 50ul
EUR 187

Phospho-VHL (S68) Antibody

  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against Phospho-VHL (S68). Recognizes Phospho-VHL (S68) from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: IHC, ELISA;IHC:1/100-1/300.ELISA:1/5000

Phospho-VHL (Ser68) Antibody

AF8334 200ul
EUR 376
Description: VHL (Phospho-Ser68) Antibody detects endogenous levels of VHL only when phosphorylated at Ser68.

VHL (Phospho- Ser68) Antibody

ABF8334 100 ug
EUR 438

Anti-VHL, Biotinylated antibody

STJ73173 100 µg
EUR 359

Anti-VHL Antibody (Biotin)

STJ502736 100 µg
EUR 586

Anti-VHL Antibody (FITC)

STJ502737 100 µg
EUR 586

Polyclonal VHL / Von Hippel Lindau Antibody (aa34-83)

APR10721G 0.05ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human VHL / Von Hippel Lindau (aa34-83). This antibody is tested and proven to work in the following applications:

Human VHL Antibody (Biotin Conjugate)

32825-05121 150 ug
EUR 369

Anti-Phospho-VHL (S68) antibody

STJ91273 200 µl
EUR 197
Description: Rabbit polyclonal to Phospho-VHL (S68).

VHL Mouse mAb

A11872-100ul 100 ul Ask for price

VHL Mouse mAb

A11872-200ul 200 ul Ask for price

VHL Mouse mAb

A11872-20ul 20 ul Ask for price

VHL Mouse mAb

A11872-50ul 50 ul
EUR 265

VHL Blocking Peptide

33R-2312 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of VHL antibody, catalog no. 70R-9757

VHL Blocking Peptide

DF6104-BP 1mg
EUR 195

VHL Blocking Peptide

AF6292-BP 1mg
EUR 195

VHL cloning plasmid

CSB-CL025852HU-10ug 10ug
EUR 255
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 519
  • Sequence: atgccccggagggcggagaactgggacgaggccgaggtaggcgcggaggaggcaggcgtcgaagagtacggccctgaagaagacggcggggaggagtcgggcgccgaggagtccggcccggaagagtccggcccggaggaactgggcgccgaggaggagatggaggccgggcggcc
  • Show more
Description: A cloning plasmid for the VHL gene.

Recombinant human VHL

P2120 100ug Ask for price
  • Uniprot ID: P40337
  • Reconstitution: Metal affinity chromatography on Fn Super Capacity Column (Nickel)
Description: Recombinant protein for human VHL

Von Hippel Lindau Tumor Suppressor (vHL) Polyclonal Antibody (Rat)

  • EUR 259.00
  • EUR 2708.00
  • EUR 670.00
  • EUR 328.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: vHL (Ala6~Gln175)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Von Hippel Lindau Tumor Suppressor (vHL)

Von Hippel Lindau Tumor Suppressor (vHL) Polyclonal Antibody (Rat), APC

  • EUR 364.00
  • EUR 3545.00
  • EUR 980.00
  • EUR 467.00
  • EUR 227.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: vHL (Ala6~Gln175)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Von Hippel Lindau Tumor Suppressor (vHL). This antibody is labeled with APC.

Von Hippel Lindau Tumor Suppressor (vHL) Polyclonal Antibody (Rat), Biotinylated

  • EUR 325.00
  • EUR 2658.00
  • EUR 777.00
  • EUR 400.00
  • EUR 225.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: vHL (Ala6~Gln175)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Von Hippel Lindau Tumor Suppressor (vHL). This antibody is labeled with Biotin.

VHL Rabbit Polyclonal Antibody

Back To Top