ZMAT3 Rabbit Polyclonal Antibody

ZMAT3 Rabbit Polyclonal Antibody

To Order: garrett@bioworldantibodies.com

ZMAT3 Polyclonal Antibody

ES9093-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ZMAT3 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

ZMAT3 Rabbit pAb

A4928-100ul 100 ul
EUR 308

ZMAT3 Rabbit pAb

A4928-200ul 200 ul
EUR 459

ZMAT3 Rabbit pAb

A4928-20ul 20 ul
EUR 183

ZMAT3 Rabbit pAb

A4928-50ul 50 ul
EUR 223

ZMAT3 antibody

70R-21389 50 ul
EUR 435
Description: Rabbit polyclonal ZMAT3 antibody

ZMAT3 Antibody

36675-100ul 100ul
EUR 252

ZMAT3 Antibody

1-CSB-PA942507
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against ZMAT3. Recognizes ZMAT3 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:2000, IHC:1:25-1:100

ZMAT3 Antibody

DF8871 200ul
EUR 304
Description: ZMAT3 Antibody detects endogenous levels of total ZMAT3.

ZMAT3 Antibody

1-CSB-PA588963
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against ZMAT3. Recognizes ZMAT3 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:50-1:200

ZMAT3 Antibody

1-CSB-PA026499GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against ZMAT3. Recognizes ZMAT3 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

ZMAT3 antibody

70R-8993 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal ZMAT3 antibody

ZMAT3 antibody

70R-51397 100 ul
EUR 244
Description: Purified Polyclonal ZMAT3 antibody

ZMAT3 Antibody

ABD13400 100 ug
EUR 438

ZMAT3 Antibody

ABD8871 100 ug
EUR 438

Polyclonal ZMAT3 antibody - N-terminal region

APR10799G 0.05mg
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human ZMAT3 - N-terminal region. This antibody is tested and proven to work in the following applications:

Zmat3/ Rat Zmat3 ELISA Kit

ELI-05060r 96 Tests
EUR 886

ZMAT3 Conjugated Antibody

C36675 100ul
EUR 397

anti- ZMAT3 antibody

FNab09648 100µg
EUR 548.75
  • Recommended dilution: WB: 1:200-1:2000
  • IP: 1:200-1:2000
  • Immunogen: zinc finger, matrin type 3
  • Uniprot ID: Q9HA38
  • Gene ID: 64393
  • Research Area: Metabolism
Description: Antibody raised against ZMAT3

Anti-ZMAT3 antibody

PAab09648 100 ug
EUR 386

Anti-ZMAT3 antibody

STJ26965 100 µl
EUR 277
Description: This gene encodes a protein containing three zinc finger domains and a nuclear localization signal. The mRNA and the protein of this gene are upregulated by wildtype p53 and overexpression of this gene inhibits tumor cell growth, suggesting that this gene may have a role in the p53-dependent growth regulatory pathway. Alternative splicing of this gene results in two transcript variants encoding two isoforms differing in only one amino acid.

Anti-ZMAT3 antibody

STJ190251 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to ZMAT3

ZMAT3 siRNA

20-abx940508
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

ZMAT3 siRNA

20-abx940509
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

ZMAT3 Blocking Peptide

33R-2659 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of ZMAT3 antibody, catalog no. 70R-8993

ZMAT3 Blocking Peptide

DF8871-BP 1mg
EUR 195

ZMAT3 Blocking Peptide

20-abx064272
  • EUR 272.00
  • EUR 411.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

ZMAT3 cloning plasmid

CSB-CL862051HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 870
  • Sequence: atgatcctcttgcaacacgccgtgcttcctccacctaagcagccctcaccctcgcctcctatgtcagtggccaccaggtctacaggaaccttgcagcttccaccacagaagccttttgggcaggaggcttccttgcctcttgcaggggaagaagagttatcgaagggaggggagca
  • Show more
Description: A cloning plasmid for the ZMAT3 gene.

ZMAT3 protein (His tag)

80R-2958 20 ug
EUR 327
Description: Purified recombinant CD59 protein (His tag)

Human ZMAT3 ELISA Kit

ELA-E1537h 96 Tests
EUR 824

ZMAT3 ELISA KIT|Human

EF005932 96 Tests
EUR 689

Rat ZMAT3 shRNA Plasmid

20-abx986236
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human ZMAT3 shRNA Plasmid

20-abx961999
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

ZMAT3 Recombinant Protein (Rat)

RP238715 100 ug Ask for price

ZMAT3 Recombinant Protein (Human)

RP035464 100 ug Ask for price

ZMAT3 Recombinant Protein (Mouse)

RP188126 100 ug Ask for price

Zinc Finger, Matrin Type 3 (ZMAT3) Antibody

20-abx116763
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Zmat3 ORF Vector (Mouse) (pORF)

ORF062710 1.0 ug DNA
EUR 506

Zmat3 ORF Vector (Rat) (pORF)

ORF079573 1.0 ug DNA
EUR 506

ZMAT3 ORF Vector (Human) (pORF)

ORF011822 1.0 ug DNA
EUR 95

ZMAT3 ELISA Kit (Mouse) (OKEH05419)

OKEH05419 96 Wells
EUR 662
Description: Description of target: Acts as a bona fide target gene of p53/TP53. May play a role in the TP53-dependent growth regulatory pathway. May contribute to TP53-mediated apoptosis by regulation of TP53 expression and translocation to the nucleus and nucleolus.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.085 ng/mL

ZMAT3 ELISA Kit (Rat) (OKEH06146)

OKEH06146 96 Wells
EUR 662
Description: Description of target: Acts as a bona fide target gene of p53/TP53. May play a role in the TP53-dependent growth regulatory pathway. May contribute to TP53-mediated apoptosis by regulation of TP53 expression and translocation to the nucleus and nucleolus.;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.086 ng/mL

ZMAT3 ELISA Kit (Human) (OKEH04229)

OKEH04229 96 Wells
EUR 662
Description: Description of target: This gene encodes a protein containing three zinc finger domains and a nuclear localization signal. The mRNA and the protein of this gene are upregulated by wildtype p53 and overexpression of this gene inhibits tumor cell growth, suggesting that this gene may have a role in the p53-dependent growth regulatory pathway. Alternative splicing of this gene results in two transcript variants encoding two isoforms differing in only one amino acid.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.1 ng/mL

Zinc Finger Matrin-Type Protein 3 (ZMAT3) Antibody

20-abx007761
  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

Zinc Finger Matrin-Type Protein 3 (ZMAT3) Antibody

20-abx003748
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Zinc finger matrin-type protein 3 (ZMAT3) Antibody

20-abx213806
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Zinc Finger Matrin-Type Protein 3 (ZMAT3) Antibody

abx036149-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Zinc Finger Matrin-Type Protein 3 (ZMAT3) Antibody

abx239648-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

Zinc finger matrin-type protein 3 (ZMAT3) Antibody

20-abx241619
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Zmat3 sgRNA CRISPR Lentivector set (Rat)

K6961401 3 x 1.0 ug
EUR 339

ZMAT3 sgRNA CRISPR Lentivector set (Human)

K2678501 3 x 1.0 ug
EUR 339

Zmat3 sgRNA CRISPR Lentivector set (Mouse)

K4478501 3 x 1.0 ug
EUR 339

Zmat3 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6961402 1.0 ug DNA
EUR 154

Zmat3 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6961403 1.0 ug DNA
EUR 154

Zmat3 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6961404 1.0 ug DNA
EUR 154

ZMAT3 sgRNA CRISPR Lentivector (Human) (Target 1)

K2678502 1.0 ug DNA
EUR 154

ZMAT3 sgRNA CRISPR Lentivector (Human) (Target 2)

K2678503 1.0 ug DNA
EUR 154

ZMAT3 sgRNA CRISPR Lentivector (Human) (Target 3)

K2678504 1.0 ug DNA
EUR 154

Zmat3 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4478502 1.0 ug DNA
EUR 154

Zmat3 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4478503 1.0 ug DNA
EUR 154

Zmat3 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4478504 1.0 ug DNA
EUR 154

ZMAT3 Protein Vector (Mouse) (pPB-C-His)

PV250838 500 ng
EUR 603

ZMAT3 Protein Vector (Mouse) (pPB-N-His)

PV250839 500 ng
EUR 603

ZMAT3 Protein Vector (Mouse) (pPM-C-HA)

PV250840 500 ng
EUR 603

ZMAT3 Protein Vector (Mouse) (pPM-C-His)

PV250841 500 ng
EUR 603

ZMAT3 Protein Vector (Rat) (pPB-C-His)

PV318290 500 ng
EUR 603

ZMAT3 Protein Vector (Rat) (pPB-N-His)

PV318291 500 ng
EUR 603

ZMAT3 Protein Vector (Rat) (pPM-C-HA)

PV318292 500 ng
EUR 603

ZMAT3 Protein Vector (Rat) (pPM-C-His)

PV318293 500 ng
EUR 603

ZMAT3 Protein Vector (Human) (pPB-C-His)

PV047285 500 ng
EUR 329

ZMAT3 Protein Vector (Human) (pPB-N-His)

PV047286 500 ng
EUR 329

ZMAT3 Protein Vector (Human) (pPM-C-HA)

PV047287 500 ng
EUR 329

ZMAT3 Protein Vector (Human) (pPM-C-His)

PV047288 500 ng
EUR 329

Recombinant Human ZMAT3 Protein, His, E.coli-100ug

QP14002-100ug 100ug
EUR 1261

Recombinant Human ZMAT3 Protein, His, E.coli-10ug

QP14002-10ug 10ug
EUR 201

Recombinant Human ZMAT3 Protein, His, E.coli-2ug

QP14002-2ug 2ug
EUR 155

Zmat3 3'UTR Luciferase Stable Cell Line

TU122987 1.0 ml Ask for price

ZMAT3 3'UTR GFP Stable Cell Line

TU078898 1.0 ml
EUR 4617

Zmat3 3'UTR GFP Stable Cell Line

TU172987 1.0 ml Ask for price

Zmat3 3'UTR Luciferase Stable Cell Line

TU223878 1.0 ml Ask for price

ZMAT3 3'UTR Luciferase Stable Cell Line

TU028898 1.0 ml
EUR 4617

Zmat3 3'UTR GFP Stable Cell Line

TU273878 1.0 ml Ask for price

ZMAT3 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV652405 1.0 ug DNA
EUR 514

ZMAT3 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV652409 1.0 ug DNA
EUR 514

ZMAT3 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV652410 1.0 ug DNA
EUR 514

GAPDH Rabbit Polyclonal Antibody

37985-100ul 100ul
EUR 252

GAPDH Rabbit Polyclonal Antibody

37985-50ul 50ul
EUR 187

EFHD1 Rabbit Polyclonal Antibody

38001-100ul 100ul
EUR 252

EFHD1 Rabbit Polyclonal Antibody

38001-50ul 50ul
EUR 187

Alliinase Rabbit Polyclonal Antibody

38042-100ul 100ul
EUR 252

Alliinase Rabbit Polyclonal Antibody

38042-50ul 50ul
EUR 187

ECFP Rabbit Polyclonal Antibody

38077-100ul 100ul
EUR 252

ECFP Rabbit Polyclonal Antibody

38077-50ul 50ul
EUR 187

EYFP Rabbit Polyclonal Antibody

38078-100ul 100ul
EUR 252

EYFP Rabbit Polyclonal Antibody

38078-50ul 50ul
EUR 187

mOrange Rabbit Polyclonal Antibody

38079-100ul 100ul
EUR 252

ZMAT3 Rabbit Polyclonal Antibody

Back To Top