ZMAT3 Rabbit Polyclonal Antibody

ZMAT3 Rabbit Polyclonal Antibody

To Order: garrett@bioworldantibodies.com

ZMAT3 Polyclonal Antibody
ES9093-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against ZMAT3 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

ZMAT3 Rabbit pAb
A4928-100ul	Abclonal	100 ul	EUR 308

ZMAT3 Rabbit pAb
A4928-200ul	Abclonal	200 ul	EUR 459

ZMAT3 Rabbit pAb
A4928-20ul	Abclonal	20 ul	EUR 183

ZMAT3 Rabbit pAb
A4928-50ul	Abclonal	50 ul	EUR 223

ZMAT3 antibody
70R-21389	Fitzgerald	50 ul	EUR 435
Description: Rabbit polyclonal ZMAT3 antibody

ZMAT3 Antibody
36675-100ul	SAB	100ul	EUR 252

ZMAT3 Antibody
1-CSB-PA942507	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against ZMAT3. Recognizes ZMAT3 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:2000, IHC:1:25-1:100

ZMAT3 Antibody
DF8871	Affbiotech	200ul	EUR 304
Description: ZMAT3 Antibody detects endogenous levels of total ZMAT3.

ZMAT3 Antibody
1-CSB-PA588963	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against ZMAT3. Recognizes ZMAT3 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:50-1:200

ZMAT3 Antibody
1-CSB-PA026499GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against ZMAT3. Recognizes ZMAT3 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

ZMAT3 antibody
70R-8993	Fitzgerald	50 ug	EUR 467
Description: Affinity purified rabbit polyclonal ZMAT3 antibody

ZMAT3 antibody
70R-51397	Fitzgerald	100 ul	EUR 244
Description: Purified Polyclonal ZMAT3 antibody

ZMAT3 Antibody
ABD13400	Lifescience Market	100 ug	EUR 438

ZMAT3 Antibody
ABD8871	Lifescience Market	100 ug	EUR 438

Polyclonal ZMAT3 antibody - N-terminal region
APR10799G	Leading Biology	0.05mg	EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human ZMAT3 - N-terminal region. This antibody is tested and proven to work in the following applications:

Zmat3/ Rat Zmat3 ELISA Kit
ELI-05060r	Lifescience Market	96 Tests	EUR 886

ZMAT3 Conjugated Antibody
C36675	SAB	100ul	EUR 397

anti- ZMAT3 antibody
FNab09648	FN Test	100µg	EUR 548.75
Recommended dilution: WB: 1:200-1:2000 IP: 1:200-1:2000 Immunogen: zinc finger, matrin type 3 Uniprot ID: Q9HA38 Gene ID: 64393 Research Area: Metabolism
Description: Antibody raised against ZMAT3

Anti-ZMAT3 antibody
PAab09648	Lifescience Market	100 ug	EUR 386

Anti-ZMAT3 antibody
STJ26965	St John's Laboratory	100 µl	EUR 277
Description: This gene encodes a protein containing three zinc finger domains and a nuclear localization signal. The mRNA and the protein of this gene are upregulated by wildtype p53 and overexpression of this gene inhibits tumor cell growth, suggesting that this gene may have a role in the p53-dependent growth regulatory pathway. Alternative splicing of this gene results in two transcript variants encoding two isoforms differing in only one amino acid.

Anti-ZMAT3 antibody
STJ190251	St John's Laboratory	200 µl	EUR 197
Description: Unconjugated Rabbit polyclonal to ZMAT3

ZMAT3 siRNA
20-abx940508	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

ZMAT3 siRNA
20-abx940509	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

ZMAT3 Blocking Peptide
33R-2659	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of ZMAT3 antibody, catalog no. 70R-8993

ZMAT3 Blocking Peptide
DF8871-BP	Affbiotech	1mg	EUR 195

ZMAT3 Blocking Peptide
20-abx064272	Abbexa	EUR 272.00 EUR 411.00	1 mg 5 mg
Shipped within 5-10 working days.

ZMAT3 cloning plasmid
CSB-CL862051HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 870 Sequence: atgatcctcttgcaacacgccgtgcttcctccacctaagcagccctcaccctcgcctcctatgtcagtggccaccaggtctacaggaaccttgcagcttccaccacagaagccttttgggcaggaggcttccttgcctcttgcaggggaagaagagttatcgaagggaggggagca Show more
Description: A cloning plasmid for the ZMAT3 gene.

ZMAT3 protein (His tag)
80R-2958	Fitzgerald	20 ug	EUR 327
Description: Purified recombinant CD59 protein (His tag)

Human ZMAT3 ELISA Kit
ELA-E1537h	Lifescience Market	96 Tests	EUR 824

ZMAT3 ELISA KIT|Human
EF005932	Lifescience Market	96 Tests	EUR 689

Rat ZMAT3 shRNA Plasmid
20-abx986236	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Human ZMAT3 shRNA Plasmid
20-abx961999	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

ZMAT3 Recombinant Protein (Rat)
RP238715	ABM	100 ug	Ask for price

ZMAT3 Recombinant Protein (Human)
RP035464	ABM	100 ug	Ask for price

ZMAT3 Recombinant Protein (Mouse)
RP188126	ABM	100 ug	Ask for price

Zinc Finger, Matrin Type 3 (ZMAT3) Antibody
20-abx116763	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

Zmat3 ORF Vector (Mouse) (pORF)
ORF062710	ABM	1.0 ug DNA	EUR 506

Zmat3 ORF Vector (Rat) (pORF)
ORF079573	ABM	1.0 ug DNA	EUR 506

ZMAT3 ORF Vector (Human) (pORF)
ORF011822	ABM	1.0 ug DNA	EUR 95

ZMAT3 ELISA Kit (Mouse) (OKEH05419)
OKEH05419	Aviva Systems Biology	96 Wells	EUR 662
Description: Description of target: Acts as a bona fide target gene of p53/TP53. May play a role in the TP53-dependent growth regulatory pathway. May contribute to TP53-mediated apoptosis by regulation of TP53 expression and translocation to the nucleus and nucleolus.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.085 ng/mL

ZMAT3 ELISA Kit (Rat) (OKEH06146)
OKEH06146	Aviva Systems Biology	96 Wells	EUR 662
Description: Description of target: Acts as a bona fide target gene of p53/TP53. May play a role in the TP53-dependent growth regulatory pathway. May contribute to TP53-mediated apoptosis by regulation of TP53 expression and translocation to the nucleus and nucleolus.;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.086 ng/mL

ZMAT3 ELISA Kit (Human) (OKEH04229)
OKEH04229	Aviva Systems Biology	96 Wells	EUR 662
Description: Description of target: This gene encodes a protein containing three zinc finger domains and a nuclear localization signal. The mRNA and the protein of this gene are upregulated by wildtype p53 and overexpression of this gene inhibits tumor cell growth, suggesting that this gene may have a role in the p53-dependent growth regulatory pathway. Alternative splicing of this gene results in two transcript variants encoding two isoforms differing in only one amino acid.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.1 ng/mL

Zinc Finger Matrin-Type Protein 3 (ZMAT3) Antibody
20-abx007761	Abbexa	EUR 300.00 EUR 439.00 EUR 189.00	100 ul 200 ul 30 ul
Shipped within 5-10 working days.

Zinc Finger Matrin-Type Protein 3 (ZMAT3) Antibody
20-abx003748	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Zinc finger matrin-type protein 3 (ZMAT3) Antibody
20-abx213806	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

Zinc Finger Matrin-Type Protein 3 (ZMAT3) Antibody
abx036149-100ug	Abbexa	100 ug	EUR 391
Shipped within 5-10 working days.

Zinc Finger Matrin-Type Protein 3 (ZMAT3) Antibody
abx239648-100ug	Abbexa	100 ug	EUR 509
Shipped within 5-12 working days.

Zinc finger matrin-type protein 3 (ZMAT3) Antibody
20-abx241619	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

Zmat3 sgRNA CRISPR Lentivector set (Rat)
K6961401	ABM	3 x 1.0 ug	EUR 339

ZMAT3 sgRNA CRISPR Lentivector set (Human)
K2678501	ABM	3 x 1.0 ug	EUR 339

Zmat3 sgRNA CRISPR Lentivector set (Mouse)
K4478501	ABM	3 x 1.0 ug	EUR 339

Zmat3 sgRNA CRISPR Lentivector (Rat) (Target 1)
K6961402	ABM	1.0 ug DNA	EUR 154

Zmat3 sgRNA CRISPR Lentivector (Rat) (Target 2)
K6961403	ABM	1.0 ug DNA	EUR 154

Zmat3 sgRNA CRISPR Lentivector (Rat) (Target 3)
K6961404	ABM	1.0 ug DNA	EUR 154

ZMAT3 sgRNA CRISPR Lentivector (Human) (Target 1)
K2678502	ABM	1.0 ug DNA	EUR 154

ZMAT3 sgRNA CRISPR Lentivector (Human) (Target 2)
K2678503	ABM	1.0 ug DNA	EUR 154

ZMAT3 sgRNA CRISPR Lentivector (Human) (Target 3)
K2678504	ABM	1.0 ug DNA	EUR 154

Zmat3 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4478502	ABM	1.0 ug DNA	EUR 154

Zmat3 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4478503	ABM	1.0 ug DNA	EUR 154

Zmat3 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4478504	ABM	1.0 ug DNA	EUR 154

ZMAT3 Protein Vector (Mouse) (pPB-C-His)
PV250838	ABM	500 ng	EUR 603

ZMAT3 Protein Vector (Mouse) (pPB-N-His)
PV250839	ABM	500 ng	EUR 603

ZMAT3 Protein Vector (Mouse) (pPM-C-HA)
PV250840	ABM	500 ng	EUR 603

ZMAT3 Protein Vector (Mouse) (pPM-C-His)
PV250841	ABM	500 ng	EUR 603

ZMAT3 Protein Vector (Rat) (pPB-C-His)
PV318290	ABM	500 ng	EUR 603

ZMAT3 Protein Vector (Rat) (pPB-N-His)
PV318291	ABM	500 ng	EUR 603

ZMAT3 Protein Vector (Rat) (pPM-C-HA)
PV318292	ABM	500 ng	EUR 603

ZMAT3 Protein Vector (Rat) (pPM-C-His)
PV318293	ABM	500 ng	EUR 603

ZMAT3 Protein Vector (Human) (pPB-C-His)
PV047285	ABM	500 ng	EUR 329

ZMAT3 Protein Vector (Human) (pPB-N-His)
PV047286	ABM	500 ng	EUR 329

ZMAT3 Protein Vector (Human) (pPM-C-HA)
PV047287	ABM	500 ng	EUR 329

ZMAT3 Protein Vector (Human) (pPM-C-His)
PV047288	ABM	500 ng	EUR 329

Recombinant Human ZMAT3 Protein, His, E.coli-100ug
QP14002-100ug	EnQuireBio	100ug	EUR 1261

Recombinant Human ZMAT3 Protein, His, E.coli-10ug
QP14002-10ug	EnQuireBio	10ug	EUR 201

Recombinant Human ZMAT3 Protein, His, E.coli-2ug
QP14002-2ug	EnQuireBio	2ug	EUR 155

Zmat3 3'UTR Luciferase Stable Cell Line
TU122987	ABM	1.0 ml	Ask for price

ZMAT3 3'UTR GFP Stable Cell Line
TU078898	ABM	1.0 ml	EUR 4617

Zmat3 3'UTR GFP Stable Cell Line
TU172987	ABM	1.0 ml	Ask for price

Zmat3 3'UTR Luciferase Stable Cell Line
TU223878	ABM	1.0 ml	Ask for price

ZMAT3 3'UTR Luciferase Stable Cell Line
TU028898	ABM	1.0 ml	EUR 4617

Zmat3 3'UTR GFP Stable Cell Line
TU273878	ABM	1.0 ml	Ask for price

ZMAT3 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)
LV652405	ABM	1.0 ug DNA	EUR 514

ZMAT3 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)
LV652409	ABM	1.0 ug DNA	EUR 514

ZMAT3 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)
LV652410	ABM	1.0 ug DNA	EUR 514

GAPDH Rabbit Polyclonal Antibody
37985-100ul	SAB	100ul	EUR 252

GAPDH Rabbit Polyclonal Antibody
37985-50ul	SAB	50ul	EUR 187

EFHD1 Rabbit Polyclonal Antibody
38001-100ul	SAB	100ul	EUR 252

EFHD1 Rabbit Polyclonal Antibody
38001-50ul	SAB	50ul	EUR 187

Alliinase Rabbit Polyclonal Antibody
38042-100ul	SAB	100ul	EUR 252

Alliinase Rabbit Polyclonal Antibody
38042-50ul	SAB	50ul	EUR 187

ECFP Rabbit Polyclonal Antibody
38077-100ul	SAB	100ul	EUR 252

ECFP Rabbit Polyclonal Antibody
38077-50ul	SAB	50ul	EUR 187

EYFP Rabbit Polyclonal Antibody
38078-100ul	SAB	100ul	EUR 252

EYFP Rabbit Polyclonal Antibody
38078-50ul	SAB	50ul	EUR 187

mOrange Rabbit Polyclonal Antibody
38079-100ul	SAB	100ul	EUR 252

ZMAT3 Rabbit Polyclonal Antibody